Mutagenetix > Incidental Mutation

Incidental Mutation 'R1250:Rag2'

151714

Institutional Source

Beutler Lab

Gene Symbol

Rag2

Ensembl Gene

ENSMUSG00000032864

Gene Name

recombination activating gene 2

Synonyms

Rag-2

MMRRC Submission

039317-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1250 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101455063-101462874 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101460784 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 365 (S365G)

Ref Sequence

ENSEMBL: ENSMUSP00000106858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]

AlphaFold

P21784

Predicted Effect

probably damaging
Transcript: ENSMUST00000044031
AA Change: S365G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: S365G

Domain	Start	End	E-Value	Type
Pfam:RAG2	51	389	3.5e-179	PFAM
Pfam:RAG2_PHD	414	491	7.2e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099682

Predicted Effect

probably damaging
Transcript: ENSMUST00000111227
AA Change: S365G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: S365G

Domain	Start	End	E-Value	Type
Pfam:RAG2	51	389	6.7e-193	PFAM
Pfam:RAG2_PHD	414	491	1.1e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111231

Predicted Effect

probably benign
Transcript: ENSMUST00000128898

Predicted Effect

probably benign
Transcript: ENSMUST00000160037

Predicted Effect

probably benign
Transcript: ENSMUST00000160722

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177171

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]

Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aptx	T	A	4: 40,693,447 (GRCm39)	E162D	probably benign	Het
Cdhr4	A	T	9: 107,874,715 (GRCm39)	Q20L	probably damaging	Het
Dlk1	A	T	12: 109,425,744 (GRCm39)	T206S	probably damaging	Het
Gabrr2	T	C	4: 33,063,273 (GRCm39)	L32P	probably benign	Het
Gjb3	G	A	4: 127,220,224 (GRCm39)	R103W	probably damaging	Het
Kntc1	T	A	5: 123,922,262 (GRCm39)	S954T	possibly damaging	Het
Krt28	A	G	11: 99,257,648 (GRCm39)		probably null	Het
Lingo3	T	C	10: 80,670,605 (GRCm39)	T442A	probably benign	Het
Map3k5	G	A	10: 19,986,521 (GRCm39)	A912T	possibly damaging	Het
Msantd3	C	A	4: 48,552,789 (GRCm39)	P126Q	probably damaging	Het
Nek10	T	C	14: 14,853,887 (GRCm38)	S358P	probably damaging	Het
Prl2c2	G	C	13: 13,176,786 (GRCm39)	T47R	probably damaging	Het
Prss59	A	T	6: 40,902,909 (GRCm39)		probably null	Het
Qtrt1	C	T	9: 21,330,844 (GRCm39)	T324M	probably benign	Het
Slc6a2	C	A	8: 93,719,491 (GRCm39)	T402K	probably benign	Het
Slc9b1	T	C	3: 135,054,531 (GRCm39)	M1T	probably null	Het
Ttn	A	G	2: 76,720,904 (GRCm39)		probably benign	Het
Vmn1r31	A	G	6: 58,449,643 (GRCm39)	V74A	probably benign	Het
Zkscan3	A	G	13: 21,572,694 (GRCm39)	F313L	probably benign	Het

Other mutations in Rag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00647:Rag2	APN	2	101,460,962 (GRCm39)	missense	probably benign	0.00
IGL01358:Rag2	APN	2	101,460,365 (GRCm39)	missense	possibly damaging	0.95
IGL01774:Rag2	APN	2	101,460,392 (GRCm39)	missense	probably damaging	1.00
IGL02267:Rag2	APN	2	101,460,376 (GRCm39)	missense	probably damaging	1.00
IGL02507:Rag2	APN	2	101,461,055 (GRCm39)	missense	probably damaging	0.99
IGL02615:Rag2	APN	2	101,459,913 (GRCm39)	nonsense	probably null
IGL02690:Rag2	APN	2	101,459,839 (GRCm39)	missense	probably benign	0.00
IGL03087:Rag2	APN	2	101,460,559 (GRCm39)	missense	probably benign	0.00
IGL03261:Rag2	APN	2	101,460,608 (GRCm39)	missense	probably damaging	0.96
billfold	UTSW	2	101,461,118 (GRCm39)	missense	probably damaging	1.00
Brag	UTSW	2	101,460,040 (GRCm39)	missense	probably damaging	1.00
excambiar	UTSW	2	101,461,121 (GRCm39)	missense	probably damaging	0.99
picker	UTSW	2	101,460,419 (GRCm39)	missense	probably damaging	1.00
snowcock	UTSW	2	101,460,948 (GRCm39)	missense	probably damaging	1.00
woodcock	UTSW	2	101,460,464 (GRCm39)	missense	probably damaging	0.98
R0266:Rag2	UTSW	2	101,460,948 (GRCm39)	missense	probably damaging	1.00
R0284:Rag2	UTSW	2	101,460,464 (GRCm39)	missense	probably damaging	0.98
R1520:Rag2	UTSW	2	101,460,476 (GRCm39)	missense	probably damaging	0.99
R1641:Rag2	UTSW	2	101,459,960 (GRCm39)	missense	probably benign	0.22
R2260:Rag2	UTSW	2	101,460,583 (GRCm39)	missense	probably benign	0.00
R2571:Rag2	UTSW	2	101,460,312 (GRCm39)	missense	probably damaging	0.99
R3441:Rag2	UTSW	2	101,460,645 (GRCm39)	missense	probably damaging	0.99
R3752:Rag2	UTSW	2	101,461,121 (GRCm39)	missense	probably damaging	0.99
R4894:Rag2	UTSW	2	101,460,022 (GRCm39)	missense	probably damaging	1.00
R5197:Rag2	UTSW	2	101,461,085 (GRCm39)	missense	probably damaging	1.00
R5236:Rag2	UTSW	2	101,460,005 (GRCm39)	missense	probably damaging	1.00
R6815:Rag2	UTSW	2	101,460,900 (GRCm39)	missense	probably damaging	0.99
R7365:Rag2	UTSW	2	101,461,118 (GRCm39)	missense	probably damaging	1.00
R7917:Rag2	UTSW	2	101,460,040 (GRCm39)	missense	probably damaging	1.00
R9026:Rag2	UTSW	2	101,460,494 (GRCm39)	missense	possibly damaging	0.46
R9243:Rag2	UTSW	2	101,460,419 (GRCm39)	missense	probably damaging	1.00
R9280:Rag2	UTSW	2	101,460,145 (GRCm39)	missense	probably benign	0.05
R9333:Rag2	UTSW	2	101,460,752 (GRCm39)	missense	probably benign	0.01
R9500:Rag2	UTSW	2	101,461,217 (GRCm39)	missense	probably damaging	1.00
X0027:Rag2	UTSW	2	101,460,718 (GRCm39)	missense	probably damaging	1.00
Z31818:Rag2	UTSW	2	101,461,150 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACAGTCTTGCCAGGAGGAATC -3'
(R):5'- GTGCCCATCCCCATGAGAACAATAG -3'

Sequencing Primer
(F):5'- AGGAGGAATCTCTGTCTCCAG -3'
(R):5'- TGTCAACATCACAAGTAGGGC -3'

Posted On

2014-01-29