Incidental Mutation 'R1250:Gjb3'
ID 151719
Institutional Source Beutler Lab
Gene Symbol Gjb3
Ensembl Gene ENSMUSG00000042367
Gene Name gap junction protein, beta 3
Synonyms Gjb-3, D4Wsu144e, Cx31, connexin 31, Cnx31
MMRRC Submission 039317-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1250 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 127219028-127224633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 127220224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 103 (R103W)
Ref Sequence ENSEMBL: ENSMUSP00000101697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046532] [ENSMUST00000106091]
AlphaFold P28231
Predicted Effect probably damaging
Transcript: ENSMUST00000046532
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046755
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106091
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101697
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene can cause non-syndromic deafness or erythrokeratodermia variabilis, a skin disorder. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial lethality and transient placental dysmorphogenesis but no impairment in hearing or skin differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aptx T A 4: 40,693,447 (GRCm39) E162D probably benign Het
Cdhr4 A T 9: 107,874,715 (GRCm39) Q20L probably damaging Het
Dlk1 A T 12: 109,425,744 (GRCm39) T206S probably damaging Het
Gabrr2 T C 4: 33,063,273 (GRCm39) L32P probably benign Het
Kntc1 T A 5: 123,922,262 (GRCm39) S954T possibly damaging Het
Krt28 A G 11: 99,257,648 (GRCm39) probably null Het
Lingo3 T C 10: 80,670,605 (GRCm39) T442A probably benign Het
Map3k5 G A 10: 19,986,521 (GRCm39) A912T possibly damaging Het
Msantd3 C A 4: 48,552,789 (GRCm39) P126Q probably damaging Het
Nek10 T C 14: 14,853,887 (GRCm38) S358P probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Prss59 A T 6: 40,902,909 (GRCm39) probably null Het
Qtrt1 C T 9: 21,330,844 (GRCm39) T324M probably benign Het
Rag2 A G 2: 101,460,784 (GRCm39) S365G probably damaging Het
Slc6a2 C A 8: 93,719,491 (GRCm39) T402K probably benign Het
Slc9b1 T C 3: 135,054,531 (GRCm39) M1T probably null Het
Ttn A G 2: 76,720,904 (GRCm39) probably benign Het
Vmn1r31 A G 6: 58,449,643 (GRCm39) V74A probably benign Het
Zkscan3 A G 13: 21,572,694 (GRCm39) F313L probably benign Het
Other mutations in Gjb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gjb3 APN 4 127,219,914 (GRCm39) missense probably damaging 0.99
IGL02398:Gjb3 APN 4 127,219,855 (GRCm39) missense probably benign 0.00
IGL02501:Gjb3 APN 4 127,220,157 (GRCm39) missense probably damaging 1.00
IGL02680:Gjb3 APN 4 127,219,815 (GRCm39) missense probably damaging 0.98
R0118:Gjb3 UTSW 4 127,220,451 (GRCm39) missense probably damaging 1.00
R0481:Gjb3 UTSW 4 127,220,125 (GRCm39) missense probably benign 0.00
R1142:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1279:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1280:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1281:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1282:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1322:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1324:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1325:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1341:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1382:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1799:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1834:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R1836:Gjb3 UTSW 4 127,220,224 (GRCm39) missense probably damaging 1.00
R4650:Gjb3 UTSW 4 127,220,484 (GRCm39) missense probably damaging 1.00
R5026:Gjb3 UTSW 4 127,220,280 (GRCm39) missense probably damaging 1.00
R6310:Gjb3 UTSW 4 127,220,433 (GRCm39) missense probably damaging 0.99
R6357:Gjb3 UTSW 4 127,220,423 (GRCm39) nonsense probably null
R9092:Gjb3 UTSW 4 127,220,471 (GRCm39) frame shift probably null
R9092:Gjb3 UTSW 4 127,220,458 (GRCm39) frame shift probably null
R9093:Gjb3 UTSW 4 127,220,458 (GRCm39) frame shift probably null
R9094:Gjb3 UTSW 4 127,220,458 (GRCm39) frame shift probably null
R9145:Gjb3 UTSW 4 127,220,140 (GRCm39) missense probably damaging 1.00
R9511:Gjb3 UTSW 4 127,220,131 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAGCAATCCACGGTGTTGGGG -3'
(R):5'- CGCATCTGGCTGTCAGTAGTGTTC -3'

Sequencing Primer
(F):5'- TGGCGCACTGTACCAGAC -3'
(R):5'- TCAGTAGTGTTCGTCTTCCG -3'
Posted On 2014-01-29