Incidental Mutation 'R1250:1700074P13Rik'
List |< first << previous [record 22 of 9592] next >> last >|
ID151721
Institutional Source Beutler Lab
Gene Symbol 1700074P13Rik
Ensembl Gene ENSMUSG00000029883
Gene NameRIKEN cDNA 1700074P13 gene
Synonyms
MMRRC Submission 039317-MU
Accession Numbers

Ncbi RefSeq: NM_028550.3; MGI: 1920731

Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R1250 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40920437-40940557 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 40925975 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031935] [ENSMUST00000122181] [ENSMUST00000136499]
Predicted Effect probably null
Transcript: ENSMUST00000031935
SMART Domains Protein: ENSMUSP00000031935
Gene: ENSMUSG00000029883

DomainStartEndE-ValueType
Tryp_SPc 24 244 4.27e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122181
SMART Domains Protein: ENSMUSP00000112987
Gene: ENSMUSG00000029883

DomainStartEndE-ValueType
Tryp_SPc 24 244 4.27e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136499
SMART Domains Protein: ENSMUSP00000116538
Gene: ENSMUSG00000029883

DomainStartEndE-ValueType
Tryp_SPc 24 174 6.08e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aptx T A 4: 40,693,447 E162D probably benign Het
Cdhr4 A T 9: 107,997,516 Q20L probably damaging Het
Dlk1 A T 12: 109,459,818 T206S probably damaging Het
Gabrr2 T C 4: 33,063,273 L32P probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kntc1 T A 5: 123,784,199 S954T possibly damaging Het
Krt28 A G 11: 99,366,822 probably null Het
Lingo3 T C 10: 80,834,771 T442A probably benign Het
Map3k5 G A 10: 20,110,775 A912T possibly damaging Het
Msantd3 C A 4: 48,552,789 P126Q probably damaging Het
Nek10 T C 14: 14,853,887 S358P probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Rag2 A G 2: 101,630,439 S365G probably damaging Het
Slc6a2 C A 8: 92,992,863 T402K probably benign Het
Slc9b1 T C 3: 135,348,770 M1T probably null Het
Ttn A G 2: 76,890,560 probably benign Het
Vmn1r31 A G 6: 58,472,658 V74A probably benign Het
Zkscan3 A G 13: 21,388,524 F313L probably benign Het
Other mutations in 1700074P13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03151:1700074P13Rik APN 6 40926012 missense probably damaging 1.00
R0041:1700074P13Rik UTSW 6 40926108 nonsense probably null
R0041:1700074P13Rik UTSW 6 40926108 nonsense probably null
R0686:1700074P13Rik UTSW 6 40928518 missense probably damaging 0.99
R0799:1700074P13Rik UTSW 6 40928599 missense probably damaging 0.97
R1499:1700074P13Rik UTSW 6 40921718 missense probably benign 0.26
R1678:1700074P13Rik UTSW 6 40929519 start gained probably benign
R1755:1700074P13Rik UTSW 6 40926162 missense probably damaging 0.99
R1891:1700074P13Rik UTSW 6 40926033 missense possibly damaging 0.73
R3160:1700074P13Rik UTSW 6 40926069 missense probably benign 0.05
R3162:1700074P13Rik UTSW 6 40926069 missense probably benign 0.05
R4194:1700074P13Rik UTSW 6 40921071 missense probably damaging 1.00
R4750:1700074P13Rik UTSW 6 40921021 missense probably damaging 1.00
R6197:1700074P13Rik UTSW 6 40921005 missense probably benign 0.05
R6217:1700074P13Rik UTSW 6 40926085 missense possibly damaging 0.88
R6394:1700074P13Rik UTSW 6 40921792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTCCCTGCACCAGTATCATGAG -3'
(R):5'- AATCCGACTGGGAGTTTACCGACC -3'

Sequencing Primer
(F):5'- GAGTTTATCCTGTCACCTCCTGG -3'
(R):5'- GGAGTTTACCGACCCAACATC -3'
Posted On2014-01-29