Incidental Mutation 'R1250:Qtrt1'
ID151724
Institutional Source Beutler Lab
Gene Symbol Qtrt1
Ensembl Gene ENSMUSG00000002825
Gene Namequeuine tRNA-ribosyltransferase catalytic subunit 1
SynonymsTgt, tRNA-guanine transglycosylase, 2610028E17Rik
MMRRC Submission 039317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R1250 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21411837-21420274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21419548 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 324 (T324M)
Ref Sequence ENSEMBL: ENSMUSP00000002902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002902] [ENSMUST00000214681] [ENSMUST00000216527]
Predicted Effect probably benign
Transcript: ENSMUST00000002902
AA Change: T324M

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002902
Gene: ENSMUSG00000002825
AA Change: T324M

DomainStartEndE-ValueType
Pfam:TGT 142 376 1.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214128
Predicted Effect probably benign
Transcript: ENSMUST00000214681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214900
Predicted Effect probably benign
Transcript: ENSMUST00000216277
Predicted Effect probably benign
Transcript: ENSMUST00000216527
Predicted Effect unknown
Transcript: ENSMUST00000217060
AA Change: T34M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217188
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine and tyrosine. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice heterozygous or homozygous for a gene trap allele exhibit reduced phenylalanine conversion to tyrosine and reduced cell levels of queuosine-modified tRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,925,975 probably null Het
Aptx T A 4: 40,693,447 E162D probably benign Het
Cdhr4 A T 9: 107,997,516 Q20L probably damaging Het
Dlk1 A T 12: 109,459,818 T206S probably damaging Het
Gabrr2 T C 4: 33,063,273 L32P probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kntc1 T A 5: 123,784,199 S954T possibly damaging Het
Krt28 A G 11: 99,366,822 probably null Het
Lingo3 T C 10: 80,834,771 T442A probably benign Het
Map3k5 G A 10: 20,110,775 A912T possibly damaging Het
Msantd3 C A 4: 48,552,789 P126Q probably damaging Het
Nek10 T C 14: 14,853,887 S358P probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rag2 A G 2: 101,630,439 S365G probably damaging Het
Slc6a2 C A 8: 92,992,863 T402K probably benign Het
Slc9b1 T C 3: 135,348,770 M1T probably null Het
Ttn A G 2: 76,890,560 probably benign Het
Vmn1r31 A G 6: 58,472,658 V74A probably benign Het
Zkscan3 A G 13: 21,388,524 F313L probably benign Het
Other mutations in Qtrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Qtrt1 APN 9 21419549 critical splice donor site probably null
IGL02048:Qtrt1 APN 9 21417355 missense probably damaging 1.00
IGL02217:Qtrt1 APN 9 21417389 critical splice donor site probably null
IGL02299:Qtrt1 APN 9 21411949 missense probably benign 0.06
R0496:Qtrt1 UTSW 9 21419548 missense probably benign 0.09
R0625:Qtrt1 UTSW 9 21418288 missense probably benign 0.43
R1173:Qtrt1 UTSW 9 21412486 missense probably benign 0.05
R1174:Qtrt1 UTSW 9 21412486 missense probably benign 0.05
R1563:Qtrt1 UTSW 9 21419311 missense probably benign 0.44
R3791:Qtrt1 UTSW 9 21419340 missense probably damaging 1.00
R4997:Qtrt1 UTSW 9 21417358 missense probably benign 0.00
R6057:Qtrt1 UTSW 9 21412003 missense probably damaging 1.00
R6762:Qtrt1 UTSW 9 21412082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGCTATGCCACCGATTTG -3'
(R):5'- GCCCTTATGGCACAGACTCTACAC -3'

Sequencing Primer
(F):5'- ACATGTTCGACTGTGTGTACC -3'
(R):5'- GGAGCCATGCTGCAAAC -3'
Posted On2014-01-29