Incidental Mutation 'R1251:Il1rn'
ID 151736
Institutional Source Beutler Lab
Gene Symbol Il1rn
Ensembl Gene ENSMUSG00000026981
Gene Name interleukin 1 receptor antagonist
Synonyms F630041P17Rik, IL-1ra
MMRRC Submission 039318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R1251 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 24226872-24241503 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24235582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 21 (R21G)
Ref Sequence ENSEMBL: ENSMUSP00000110131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114482] [ENSMUST00000114485] [ENSMUST00000114487] [ENSMUST00000142093]
AlphaFold P25085
Predicted Effect probably damaging
Transcript: ENSMUST00000114482
AA Change: R40G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110126
Gene: ENSMUSG00000026981
AA Change: R40G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL1 34 175 2.88e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114485
AA Change: R24G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110129
Gene: ENSMUSG00000026981
AA Change: R24G

DomainStartEndE-ValueType
IL1 18 159 2.88e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114487
AA Change: R21G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110131
Gene: ENSMUSG00000026981
AA Change: R21G

DomainStartEndE-ValueType
IL1 15 156 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142093
AA Change: R21G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141269
Gene: ENSMUSG00000026981
AA Change: R21G

DomainStartEndE-ValueType
PDB:1IRP|A 8 50 1e-21 PDB
Blast:IL1 15 50 9e-20 BLAST
SCOP:d1ilr1_ 16 50 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143423
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]
PHENOTYPE: Nullizygous mutations of this gene may result in decreased body weight, increased inflammatory response to turpentine and LPS, decreased susceptibility to bacterial infection, psoriasis, aortitis, rheumatoid arthritis, and abnormal dendritic and CD4-positive T cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Acap2 A T 16: 30,926,989 (GRCm39) Y509N probably damaging Het
Adcy9 T A 16: 4,129,395 (GRCm39) E497V probably damaging Het
Bcat2 T G 7: 45,225,410 (GRCm39) L56R probably damaging Het
Ccdc146 T C 5: 21,498,370 (GRCm39) M952V probably benign Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Cfap46 C T 7: 139,181,181 (GRCm39) V2607I probably benign Het
Clec18a T C 8: 111,808,270 (GRCm39) I54V possibly damaging Het
Coil A G 11: 88,873,125 (GRCm39) E455G possibly damaging Het
Copg1 A T 6: 87,866,989 (GRCm39) K75* probably null Het
Cyp2j12 G A 4: 96,003,903 (GRCm39) Q238* probably null Het
Eif3i T C 4: 129,487,178 (GRCm39) E229G probably damaging Het
Exoc2 T A 13: 31,070,259 (GRCm39) N411Y probably benign Het
Eya2 T A 2: 165,596,404 (GRCm39) M305K probably damaging Het
Faim C T 9: 98,874,687 (GRCm39) T78M probably damaging Het
Fgg T A 3: 82,920,287 (GRCm39) D355E probably benign Het
Foxn1 A G 11: 78,249,611 (GRCm39) L638P probably damaging Het
Grid2ip A T 5: 143,371,770 (GRCm39) E664D possibly damaging Het
Ilrun C T 17: 28,005,044 (GRCm39) probably null Het
Inpp4b G A 8: 82,617,382 (GRCm39) G220R probably benign Het
Irx6 A G 8: 93,404,881 (GRCm39) S250G possibly damaging Het
Lyst T C 13: 13,809,068 (GRCm39) I246T probably benign Het
Mcm3 G A 1: 20,882,896 (GRCm39) Q353* probably null Het
Mfhas1 A G 8: 36,058,207 (GRCm39) Y894C probably damaging Het
Mfsd13a T C 19: 46,360,492 (GRCm39) L348P probably damaging Het
Necab1 A G 4: 15,111,192 (GRCm39) probably null Het
Nectin3 A T 16: 46,284,205 (GRCm39) S160T possibly damaging Het
Npc2 A G 12: 84,807,658 (GRCm39) S67P probably damaging Het
Or5e1 T G 7: 108,354,114 (GRCm39) F17C probably damaging Het
Or5m9b G A 2: 85,905,164 (GRCm39) V27M probably benign Het
Pcnx3 A G 19: 5,727,210 (GRCm39) F1108L probably benign Het
Phf21a G A 2: 92,189,544 (GRCm39) S601N probably benign Het
Pold1 C T 7: 44,184,475 (GRCm39) V842I probably benign Het
Rabgap1 A G 2: 37,433,246 (GRCm39) probably null Het
Setd1a T A 7: 127,396,596 (GRCm39) probably benign Het
Sgo2a A T 1: 58,039,121 (GRCm39) probably null Het
Sult2a8 T A 7: 14,159,350 (GRCm39) K90* probably null Het
Tlr2 T C 3: 83,745,576 (GRCm39) D169G possibly damaging Het
Tmem95 A G 11: 69,767,655 (GRCm39) F153S probably benign Het
Tube1 G T 10: 39,010,204 (GRCm39) G10* probably null Het
Vmn2r10 T C 5: 109,143,890 (GRCm39) M687V probably benign Het
Zc3h8 G A 2: 128,777,289 (GRCm39) P117S probably benign Het
Zeb1 T A 18: 5,705,089 (GRCm39) D18E probably damaging Het
Other mutations in Il1rn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Il1rn APN 2 24,239,551 (GRCm39) missense probably damaging 1.00
IGL02606:Il1rn APN 2 24,235,462 (GRCm39) intron probably benign
R1943:Il1rn UTSW 2 24,238,611 (GRCm39) missense possibly damaging 0.94
R4284:Il1rn UTSW 2 24,239,557 (GRCm39) missense probably damaging 0.96
R4285:Il1rn UTSW 2 24,239,557 (GRCm39) missense probably damaging 0.96
R4287:Il1rn UTSW 2 24,239,557 (GRCm39) missense probably damaging 0.96
R5317:Il1rn UTSW 2 24,239,554 (GRCm39) missense probably benign 0.30
R5322:Il1rn UTSW 2 24,238,641 (GRCm39) critical splice donor site probably null
R6662:Il1rn UTSW 2 24,226,887 (GRCm39) start gained probably null
R7427:Il1rn UTSW 2 24,239,554 (GRCm39) missense probably benign 0.16
R8821:Il1rn UTSW 2 24,239,505 (GRCm39) missense possibly damaging 0.74
R8831:Il1rn UTSW 2 24,239,505 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGCAACCACCTTGAGCCTGAAATG -3'
(R):5'- CGGATGCCTGTCCATCACTTACTG -3'

Sequencing Primer
(F):5'- AAATGGCAGTCGCTAGTCTC -3'
(R):5'- cacacacacacacacacac -3'
Posted On 2014-01-29