Incidental Mutation 'R1252:Nmbr'
ID151806
Institutional Source Beutler Lab
Gene Symbol Nmbr
Ensembl Gene ENSMUSG00000019865
Gene Nameneuromedin B receptor
Synonyms
MMRRC Submission 039319-MU
Accession Numbers

Genbank: NM_008703

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location14705591-14770850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14760443 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 52 (I52T)
Ref Sequence ENSEMBL: ENSMUSP00000139612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020015] [ENSMUST00000186382] [ENSMUST00000190114] [ENSMUST00000190751] [ENSMUST00000191238]
Predicted Effect probably benign
Transcript: ENSMUST00000020015
AA Change: I52T

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020015
Gene: ENSMUSG00000019865
AA Change: I52T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 54 339 5.9e-9 PFAM
Pfam:7tm_1 60 325 2.9e-55 PFAM
Pfam:7TM_GPCR_Srv 92 341 2.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181479
Predicted Effect probably benign
Transcript: ENSMUST00000186382
AA Change: I52T

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139612
Gene: ENSMUSG00000019865
AA Change: I52T

DomainStartEndE-ValueType
Pfam:7tm_1 60 257 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188021
Predicted Effect probably benign
Transcript: ENSMUST00000190114
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190751
AA Change: I52T

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140223
Gene: ENSMUSG00000019865
AA Change: I52T

DomainStartEndE-ValueType
Pfam:7tm_1 60 144 2.7e-21 PFAM
transmembrane domain 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane G protein-coupled receptor that binds neuromedin B, which is a growth factor and mitogen for gastrointestinal epithelial tissue and for normal and neoplastic lung. This receptor may play a role in smooth muscle contraction, neuronal responses, and the regulation of cell growth. Antagonists of this receptor have a potential therapeutic use in inhibiting tumor cell growth. Polymorphisms in this gene may be associated with a susceptibility for schizophrenia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show a 50% reduction in the thermoregulatory response to neuromedin B as well as impaired maternal behavior in response to restraint-induced stress. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Nmbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Nmbr APN 10 14770429 missense probably benign 0.19
IGL01874:Nmbr APN 10 14766952 missense probably benign 0.09
IGL02616:Nmbr APN 10 14760687 intron probably benign
IGL02619:Nmbr APN 10 14760587 missense probably damaging 0.99
IGL03015:Nmbr APN 10 14760668 missense probably damaging 1.00
G5030:Nmbr UTSW 10 14767003 missense possibly damaging 0.95
R0057:Nmbr UTSW 10 14760524 missense probably damaging 0.97
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0324:Nmbr UTSW 10 14760448 missense possibly damaging 0.50
R1812:Nmbr UTSW 10 14760539 intron probably null
R1831:Nmbr UTSW 10 14766865 missense probably benign 0.36
R2140:Nmbr UTSW 10 14770442 nonsense probably null
R2141:Nmbr UTSW 10 14770442 nonsense probably null
R4604:Nmbr UTSW 10 14770164 missense probably damaging 1.00
R4936:Nmbr UTSW 10 14766986 missense probably damaging 1.00
R5965:Nmbr UTSW 10 14766810 missense probably benign 0.01
R6636:Nmbr UTSW 10 14770234 missense probably benign 0.23
R6895:Nmbr UTSW 10 14769960 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGAAAACTCCTGCGAGTTCC -3'
(R):5'- CATGCTTTTCTCGGTGGCACAC -3'

Sequencing Primer
(F):5'- TGCGAGTTCCCTGGGAAAAG -3'
(R):5'- ATGAGTTTGCAGCCCAGC -3'
Posted On2014-01-29