Incidental Mutation 'R1252:Lrrc45'
ID151810
Institutional Source Beutler Lab
Gene Symbol Lrrc45
Ensembl Gene ENSMUSG00000025145
Gene Nameleucine rich repeat containing 45
Synonyms
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120713925-120721128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120715471 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 135 (T135N)
Ref Sequence ENSEMBL: ENSMUSP00000123038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026137] [ENSMUST00000026139] [ENSMUST00000055424] [ENSMUST00000106154] [ENSMUST00000106155] [ENSMUST00000145781] [ENSMUST00000151852]
Predicted Effect probably benign
Transcript: ENSMUST00000026137
SMART Domains Protein: ENSMUSP00000026137
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 55 107 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026139
AA Change: T135N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145
AA Change: T135N

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055424
SMART Domains Protein: ENSMUSP00000050335
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 8 78 7.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106154
SMART Domains Protein: ENSMUSP00000101760
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 44 114 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106155
SMART Domains Protein: ENSMUSP00000101761
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128543
Predicted Effect probably benign
Transcript: ENSMUST00000145781
AA Change: T135N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145
AA Change: T135N

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150225
Predicted Effect probably benign
Transcript: ENSMUST00000151852
AA Change: T135N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145
AA Change: T135N

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155187
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Lrrc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Lrrc45 APN 11 120720610 splice site probably benign
IGL01120:Lrrc45 APN 11 120720010 missense probably benign
IGL01536:Lrrc45 APN 11 120715584 missense probably benign 0.01
IGL01839:Lrrc45 APN 11 120717149 unclassified probably null
IGL02190:Lrrc45 APN 11 120718508 missense probably damaging 0.99
IGL02302:Lrrc45 APN 11 120718525 missense possibly damaging 0.68
IGL02724:Lrrc45 APN 11 120718318 missense probably benign 0.25
R0396:Lrrc45 UTSW 11 120714907 splice site probably benign
R0420:Lrrc45 UTSW 11 120715219 missense probably damaging 1.00
R0540:Lrrc45 UTSW 11 120715162 nonsense probably null
R0833:Lrrc45 UTSW 11 120718193 unclassified probably null
R0942:Lrrc45 UTSW 11 120718238 unclassified probably benign
R1426:Lrrc45 UTSW 11 120720013 missense probably benign 0.00
R1543:Lrrc45 UTSW 11 120720018 missense probably benign 0.06
R1570:Lrrc45 UTSW 11 120720109 critical splice donor site probably null
R2392:Lrrc45 UTSW 11 120719539 missense probably benign 0.00
R3000:Lrrc45 UTSW 11 120718447 missense probably benign 0.00
R3930:Lrrc45 UTSW 11 120718677 missense probably benign 0.06
R4158:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4161:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4432:Lrrc45 UTSW 11 120715221 critical splice donor site probably null
R4647:Lrrc45 UTSW 11 120719121 missense probably benign 0.02
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6220:Lrrc45 UTSW 11 120719527 missense probably benign 0.37
X0026:Lrrc45 UTSW 11 120720232 missense probably damaging 1.00
Z1088:Lrrc45 UTSW 11 120720231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAAAGCTCCTTCGACAGAAC -3'
(R):5'- GGACAGGGTGCAACTTAATACAGCC -3'

Sequencing Primer
(F):5'- TCCTTCGACAGAACAAGTCTATTCAG -3'
(R):5'- GGTGCAACTTAATACAGCCCAATG -3'
Posted On2014-01-29