Incidental Mutation 'R1253:Olfr364-ps1'
ID151829
Institutional Source Beutler Lab
Gene Symbol Olfr364-ps1
Ensembl Gene ENSMUSG00000078198
Gene Nameolfactory receptor 364, pseudogene 1
SynonymsGA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1253 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37139322-37148585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37146872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 220 (V220D)
Ref Sequence ENSEMBL: ENSMUSP00000151166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104995] [ENSMUST00000214905] [ENSMUST00000217298]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104995
AA Change: V220D

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100611
Gene: ENSMUSG00000078198
AA Change: V220D

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 4.8e-58 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214905
AA Change: V220D

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217298
AA Change: V220D

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 G A 6: 83,522,887 T127I probably damaging Het
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Large1 T C 8: 73,048,422 Y220C probably damaging Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Mtus2 C T 5: 148,303,570 Q76* probably null Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr731 A G 14: 50,238,124 C254R probably damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rexo2 A T 9: 48,468,932 I200N probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Tas2r129 T C 6: 132,952,036 I312T probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Olfr364-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr364-ps1 APN 2 37147067 missense probably damaging 1.00
IGL01550:Olfr364-ps1 APN 2 37146974 missense probably damaging 1.00
IGL01791:Olfr364-ps1 APN 2 37146536 missense probably damaging 1.00
IGL01886:Olfr364-ps1 APN 2 37146509 missense probably damaging 1.00
IGL02680:Olfr364-ps1 APN 2 37146415 missense probably damaging 1.00
IGL03003:Olfr364-ps1 APN 2 37146452 missense probably benign 0.00
IGL03289:Olfr364-ps1 APN 2 37146578 missense probably damaging 1.00
R0627:Olfr364-ps1 UTSW 2 37146330 missense probably damaging 0.96
R1163:Olfr364-ps1 UTSW 2 37147027 missense probably damaging 1.00
R1340:Olfr364-ps1 UTSW 2 37146757 missense probably benign 0.03
R1542:Olfr364-ps1 UTSW 2 37146966 missense probably damaging 1.00
R1633:Olfr364-ps1 UTSW 2 37146971 missense probably damaging 0.99
R2935:Olfr364-ps1 UTSW 2 37147111 missense possibly damaging 0.75
R2982:Olfr364-ps1 UTSW 2 37146381 missense probably damaging 0.99
R3855:Olfr364-ps1 UTSW 2 37146823 missense possibly damaging 0.95
R4849:Olfr364-ps1 UTSW 2 37146254 missense probably damaging 0.97
R4903:Olfr364-ps1 UTSW 2 37146371 missense probably benign 0.35
R5160:Olfr364-ps1 UTSW 2 37146803 missense probably benign 0.03
R7092:Olfr364-ps1 UTSW 2 37146611 missense probably damaging 1.00
R7108:Olfr364-ps1 UTSW 2 37146260 missense probably benign 0.00
R7143:Olfr364-ps1 UTSW 2 37146874 missense probably benign 0.00
R7278:Olfr364-ps1 UTSW 2 37147009 missense probably benign 0.29
Z1088:Olfr364-ps1 UTSW 2 37146385 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGATGTGGTGATGAGGTCACAACG -3'
(R):5'- GAGTGAAGCCTGTCCCTTAACTTCC -3'

Sequencing Primer
(F):5'- ATGAGGTCACAACGCTGCC -3'
(R):5'- GGATTCATCATAGGTGTCACTACTG -3'
Posted On2014-01-29