Incidental Mutation 'R1239:Dnajc6'
ID151873
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
MMRRC Submission 039306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1239 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101635116 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 783 (Y783H)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038207
AA Change: Y753H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: Y753H

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094953
AA Change: Y715H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: Y715H

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106929
AA Change: Y715H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: Y715H

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106930
AA Change: Y715H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: Y715H

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: Y783H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: Y783H

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik GTTCTTC GTTC 9: 22,424,699 probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Adcy8 G T 15: 64,716,062 R959S probably damaging Het
Ank1 A G 8: 23,096,155 N455D probably damaging Het
Ankrd17 T C 5: 90,288,676 T589A probably damaging Het
BC022687 A G 12: 112,809,503 R39G probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Celsr1 G T 15: 85,979,146 N1228K probably damaging Het
Ces4a T C 8: 105,149,498 L557P probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Col27a1 T C 4: 63,318,915 probably benign Het
Cplx2 G T 13: 54,379,602 A100S probably damaging Het
Cpsf6 G A 10: 117,361,343 probably benign Het
Cyp1a2 A G 9: 57,681,767 F255L probably benign Het
D10Jhu81e A G 10: 78,168,927 probably benign Het
E230025N22Rik T C 18: 36,685,475 I434V probably damaging Het
Ermap T C 4: 119,188,925 K3E probably benign Het
Gm14139 T C 2: 150,191,971 Y71H possibly damaging Het
Gstm2 G A 3: 107,984,028 L125F possibly damaging Het
Hk2 C T 6: 82,749,308 G58R probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Mgmt T C 7: 137,128,057 F200S probably benign Het
Mug2 T G 6: 122,081,678 probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1463 G A 19: 13,234,676 C142Y possibly damaging Het
Olfr235 G T 19: 12,268,976 V249F probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phc3 A G 3: 30,914,130 V886A probably damaging Het
Plcg2 T A 8: 117,556,044 V88D probably benign Het
Podxl2 C T 6: 88,849,983 V50I probably benign Het
Rap1gap G T 4: 137,717,996 M329I probably damaging Het
Rbm5 A G 9: 107,752,966 probably benign Het
Robo1 A G 16: 73,024,542 probably null Het
Ryr2 A T 13: 11,883,043 probably null Het
Skida1 A C 2: 18,047,317 probably benign Het
Tecta A G 9: 42,332,485 F2024L probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Vmn1r16 C T 6: 57,323,633 M1I probably null Het
Zbtb39 G T 10: 127,743,069 G504V probably damaging Het
Zfp106 A T 2: 120,533,594 N777K probably damaging Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense not run
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACCACCCAAAGCAGTTTCCAC -3'
(R):5'- GTACGACAATACAGGCAGGTCACC -3'

Sequencing Primer
(F):5'- AGCAATGCCTTGTGACCC -3'
(R):5'- AGGTCACCCTGTACCAGTC -3'
Posted On2014-01-29