Incidental Mutation 'R1239:Trim43a'
ID151889
Institutional Source Beutler Lab
Gene Symbol Trim43a
Ensembl Gene ENSMUSG00000090693
Gene Nametripartite motif-containing 43A
SynonymsGm6021
MMRRC Submission 039306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1239 (G1)
Quality Score198
Status Validated
Chromosome9
Chromosomal Location88580891-88588819 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT at 88582989 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164661] [ENSMUST00000215498] [ENSMUST00000216686]
Predicted Effect probably benign
Transcript: ENSMUST00000164661
SMART Domains Protein: ENSMUSP00000127527
Gene: ENSMUSG00000090693

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 1e-7 BLAST
PDB:2VOK|B 328 445 5e-14 PDB
Blast:SPRY 335 441 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000215498
Predicted Effect probably benign
Transcript: ENSMUST00000216686
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik GTTCTTC GTTC 9: 22,424,699 probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Adcy8 G T 15: 64,716,062 R959S probably damaging Het
Ank1 A G 8: 23,096,155 N455D probably damaging Het
Ankrd17 T C 5: 90,288,676 T589A probably damaging Het
BC022687 A G 12: 112,809,503 R39G probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Celsr1 G T 15: 85,979,146 N1228K probably damaging Het
Ces4a T C 8: 105,149,498 L557P probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Col27a1 T C 4: 63,318,915 probably benign Het
Cplx2 G T 13: 54,379,602 A100S probably damaging Het
Cpsf6 G A 10: 117,361,343 probably benign Het
Cyp1a2 A G 9: 57,681,767 F255L probably benign Het
D10Jhu81e A G 10: 78,168,927 probably benign Het
Dnajc6 T C 4: 101,635,116 Y783H probably damaging Het
E230025N22Rik T C 18: 36,685,475 I434V probably damaging Het
Ermap T C 4: 119,188,925 K3E probably benign Het
Gm14139 T C 2: 150,191,971 Y71H possibly damaging Het
Gstm2 G A 3: 107,984,028 L125F possibly damaging Het
Hk2 C T 6: 82,749,308 G58R probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Mgmt T C 7: 137,128,057 F200S probably benign Het
Mug2 T G 6: 122,081,678 probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1463 G A 19: 13,234,676 C142Y possibly damaging Het
Olfr235 G T 19: 12,268,976 V249F probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phc3 A G 3: 30,914,130 V886A probably damaging Het
Plcg2 T A 8: 117,556,044 V88D probably benign Het
Podxl2 C T 6: 88,849,983 V50I probably benign Het
Rap1gap G T 4: 137,717,996 M329I probably damaging Het
Rbm5 A G 9: 107,752,966 probably benign Het
Robo1 A G 16: 73,024,542 probably null Het
Ryr2 A T 13: 11,883,043 probably null Het
Skida1 A C 2: 18,047,317 probably benign Het
Tecta A G 9: 42,332,485 F2024L probably damaging Het
Vmn1r16 C T 6: 57,323,633 M1I probably null Het
Zbtb39 G T 10: 127,743,069 G504V probably damaging Het
Zfp106 A T 2: 120,533,594 N777K probably damaging Het
Other mutations in Trim43a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02400:Trim43a APN 9 88582112 missense probably benign 0.00
IGL02864:Trim43a APN 9 88588112 missense probably benign 0.20
R0114:Trim43a UTSW 9 88584160 missense probably damaging 1.00
R0436:Trim43a UTSW 9 88588187 missense probably damaging 1.00
R0514:Trim43a UTSW 9 88584336 nonsense probably null
R0682:Trim43a UTSW 9 88582146 missense probably benign 0.08
R0709:Trim43a UTSW 9 88582146 missense probably benign 0.08
R0727:Trim43a UTSW 9 88582146 missense probably benign 0.08
R1237:Trim43a UTSW 9 88582989 intron probably benign
R1445:Trim43a UTSW 9 88582989 intron probably benign
R1448:Trim43a UTSW 9 88582093 missense probably damaging 1.00
R1584:Trim43a UTSW 9 88588158 missense probably damaging 1.00
R1925:Trim43a UTSW 9 88582318 missense probably benign 0.08
R1992:Trim43a UTSW 9 88584259 missense probably damaging 1.00
R2074:Trim43a UTSW 9 88586094 missense possibly damaging 0.91
R3927:Trim43a UTSW 9 88582989 intron probably benign
R3930:Trim43a UTSW 9 88583078 missense probably benign 0.04
R4418:Trim43a UTSW 9 88582153 missense probably damaging 1.00
R5488:Trim43a UTSW 9 88582176 missense probably damaging 0.97
R5489:Trim43a UTSW 9 88582176 missense probably damaging 0.97
R6498:Trim43a UTSW 9 88582342 missense probably damaging 1.00
R6742:Trim43a UTSW 9 88588346 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCAGCCAGTCCTCAACTATGCTAC -3'
(R):5'- GAAGGGCTTGGATCACTCCTCAATG -3'

Sequencing Primer
(F):5'- ACATCACTTTACTTGAGCCCAG -3'
(R):5'- TGAATGTCTCTGGCCTCAAAG -3'
Posted On2014-01-29