Incidental Mutation 'R1240:Olfr32'
ID151913
Institutional Source Beutler Lab
Gene Symbol Olfr32
Ensembl Gene ENSMUSG00000075066
Gene Nameolfactory receptor 32
SynonymsMOR227-9_p, GA_x6K02T2Q125-51573576-51572650, MOR227-7P, MTPCR05
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1240 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90136273-90142296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90138813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 109 (I109L)
Ref Sequence ENSEMBL: ENSMUSP00000150239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099755] [ENSMUST00000213293] [ENSMUST00000214973] [ENSMUST00000215153] [ENSMUST00000215659] [ENSMUST00000215765]
Predicted Effect probably benign
Transcript: ENSMUST00000099755
AA Change: I109L

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097344
Gene: ENSMUSG00000075066
AA Change: I109L

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.7e-52 PFAM
Pfam:7tm_1 38 284 6.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213293
AA Change: I109L

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000214973
AA Change: I109L

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215153
AA Change: I109L

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215659
AA Change: I109L

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000215765
AA Change: I109L

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Olfr32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr32 APN 2 90139074 missense probably benign 0.30
IGL01976:Olfr32 APN 2 90138924 missense probably damaging 1.00
IGL02076:Olfr32 APN 2 90138815 missense probably damaging 1.00
IGL03030:Olfr32 APN 2 90138662 missense possibly damaging 0.93
IGL03235:Olfr32 APN 2 90139070 missense possibly damaging 0.88
IGL03410:Olfr32 APN 2 90139145 start gained probably benign
R1511:Olfr32 UTSW 2 90138404 missense probably benign 0.13
R1602:Olfr32 UTSW 2 90139055 missense probably damaging 1.00
R1828:Olfr32 UTSW 2 90138587 missense probably damaging 0.99
R2023:Olfr32 UTSW 2 90138856 nonsense probably null
R2177:Olfr32 UTSW 2 90138464 missense possibly damaging 0.70
R2679:Olfr32 UTSW 2 90138545 missense possibly damaging 0.93
R4490:Olfr32 UTSW 2 90138917 missense probably damaging 0.97
R4585:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4586:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4649:Olfr32 UTSW 2 90139088 missense probably damaging 0.99
R4688:Olfr32 UTSW 2 90138999 missense possibly damaging 0.80
R4694:Olfr32 UTSW 2 90138249 nonsense probably null
R5245:Olfr32 UTSW 2 90138262 missense probably damaging 1.00
R5509:Olfr32 UTSW 2 90138892 missense probably damaging 1.00
R5991:Olfr32 UTSW 2 90138234 nonsense probably null
R6004:Olfr32 UTSW 2 90138999 missense probably benign 0.32
R6128:Olfr32 UTSW 2 90138610 nonsense probably null
R6519:Olfr32 UTSW 2 90138812 missense possibly damaging 0.90
X0066:Olfr32 UTSW 2 90138390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACATTGGGACCACAGAAAGGC -3'
(R):5'- TGTGACTGAGTTGATCATCACTGGC -3'

Sequencing Primer
(F):5'- CAAAGGGAGAGTGATGAAAATCTG -3'
(R):5'- ACATCAGTAAGAGTCTGTATTCCCC -3'
Posted On2014-01-29