Incidental Mutation 'R1240:Ccdc73'
ID151914
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Namecoiled-coil domain containing 73
Synonyms2210415I11Rik
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1240 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104867805-105017904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104991561 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 618 (E618D)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
Predicted Effect probably benign
Transcript: ENSMUST00000111114
AA Change: E618D

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: E618D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104994591 missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104907627 missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104975616 missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104907568 missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104991840 unclassified probably benign
FR4737:Ccdc73 UTSW 2 104991840 unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104951936 missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104980987 splice site probably benign
R0040:Ccdc73 UTSW 2 104992084 missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104929570 splice site probably benign
R0360:Ccdc73 UTSW 2 104981007 missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104991289 missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104973154 splice site probably benign
R0839:Ccdc73 UTSW 2 104991097 missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104992190 missense possibly damaging 0.51
R1478:Ccdc73 UTSW 2 104907610 missense possibly damaging 0.72
R1478:Ccdc73 UTSW 2 104914667 missense possibly damaging 0.93
R1695:Ccdc73 UTSW 2 104992105 missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104992292 missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104926935 missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104931045 nonsense probably null
R1987:Ccdc73 UTSW 2 104999159 missense probably damaging 1.00
R2938:Ccdc73 UTSW 2 104975635 nonsense probably null
R3420:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3420:Ccdc73 UTSW 2 104951948 splice site probably null
R3422:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3422:Ccdc73 UTSW 2 104951948 splice site probably null
R3522:Ccdc73 UTSW 2 104991485 missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104991343 missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104985010 missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104981105 splice site probably null
R4793:Ccdc73 UTSW 2 105017782 utr 3 prime probably null
R4939:Ccdc73 UTSW 2 104992157 unclassified probably null
R4950:Ccdc73 UTSW 2 104992366 missense probably benign
R5093:Ccdc73 UTSW 2 105017766 utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104992039 missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104989925 missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104930986 missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104992137 missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104907633 missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104992088 missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104991524 nonsense probably null
R7062:Ccdc73 UTSW 2 104951878 missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104973224 missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104999176 missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104951869 missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104994570 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGGACACTCGAAGTAACAAAGCATC -3'
(R):5'- GACACTCACACTACTTTCTGAAGCTCC -3'

Sequencing Primer
(F):5'- GAAGTAACAAAGCATCCTCTAATGG -3'
(R):5'- GAAGCTCCCAGATGGTTCCTAAG -3'
Posted On2014-01-29