Incidental Mutation 'R1240:Plxna1'
ID151934
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R1240 (G1)
Quality Score143
Status Not validated
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89321050 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1749 (V1749M)
Ref Sequence ENSEMBL: ENSMUSP00000131840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
Predicted Effect probably damaging
Transcript: ENSMUST00000049845
AA Change: V1749M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: V1749M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163139
AA Change: V1749M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: V1749M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181258
Predicted Effect probably benign
Transcript: ENSMUST00000204468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205230
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCATCTTGGCAATGTCAGCATAG -3'
(R):5'- GAGGATTGATGCTCTGAGAGGCAC -3'

Sequencing Primer
(F):5'- TGGCAATGTCAGCATAGTACCTG -3'
(R):5'- TCTGAGAGGCACCAGGTTG -3'
Posted On2014-01-29