Incidental Mutation 'R1240:Ankfn1'
ID151948
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Nameankyrin-repeat and fibronectin type III domain containing 1
SynonymsLOC382543
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R1240 (G1)
Quality Score117
Status Not validated
Chromosome11
Chromosomal Location89390223-89777653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89392134 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 229 (L229P)
Ref Sequence ENSEMBL: ENSMUSP00000049776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050983]
Predicted Effect probably damaging
Transcript: ENSMUST00000050983
AA Change: L229P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049776
Gene: ENSMUSG00000047773
AA Change: L229P

DomainStartEndE-ValueType
low complexity region 207 220 N/A INTRINSIC
low complexity region 377 394 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207815
AA Change: L908P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208932
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89391639 missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89405678 missense probably benign
IGL02695:Ankfn1 APN 11 89391819 missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89538466 missense probably benign
IGL02821:Ankfn1 APN 11 89391616 missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89538438 missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89391676 missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89441966 missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89392087 missense probably benign
R1534:Ankfn1 UTSW 11 89523151 missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89441391 missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89526541 missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89422767 critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89526474 missense possibly damaging 0.74
R1835:Ankfn1 UTSW 11 89447618 missense probably benign 0.25
R2012:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89456120 missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89526537 missense probably damaging 1.00
R2876:Ankfn1 UTSW 11 89391636 missense possibly damaging 0.90
R3778:Ankfn1 UTSW 11 89441394 missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89441426 missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89441442 missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89391928 missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89505181 missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89453187 missense probably damaging 1.00
R5458:Ankfn1 UTSW 11 89434810 missense probably benign 0.00
R5710:Ankfn1 UTSW 11 89503925 missense probably benign 0.02
R6457:Ankfn1 UTSW 11 89391844 missense probably benign 0.00
X0012:Ankfn1 UTSW 11 89425544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGACAGGTGCTGGGTGTAAAC -3'
(R):5'- TCCTCCCCACAGACAGTGACTATG -3'

Sequencing Primer
(F):5'- TGCTGGGTGTAAACACCTTC -3'
(R):5'- TGACTATGACTCCAGCGATG -3'
Posted On2014-01-29