Incidental Mutation 'R1240:Cdh6'
ID151957
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Namecadherin 6
Synonymscad6, K-cadherin
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R1240 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location13028701-13173675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13057455 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 260 (D260V)
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
PDB Structure
Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036439
AA Change: D260V

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385
AA Change: D260V

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226917
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13034359 nonsense probably null
IGL00675:Cdh6 APN 15 13041439 missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13064495 missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13051309 missense probably benign 0.40
IGL01351:Cdh6 APN 15 13034240 missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13034190 utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13064430 missense possibly damaging 0.94
R0124:Cdh6 UTSW 15 13034324 missense probably damaging 1.00
R0256:Cdh6 UTSW 15 13053782 splice site probably benign
R0696:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R1017:Cdh6 UTSW 15 13051476 missense probably benign 0.06
R1444:Cdh6 UTSW 15 13091838 missense probably benign 0.00
R2008:Cdh6 UTSW 15 13051476 missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13057501 missense probably benign
R2507:Cdh6 UTSW 15 13041361 missense probably benign 0.10
R3082:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3083:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13042575 missense probably benign 0.39
R4591:Cdh6 UTSW 15 13051486 missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R4898:Cdh6 UTSW 15 13034688 missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13064411 missense probably benign 0.05
R5313:Cdh6 UTSW 15 13034637 missense probably damaging 1.00
R5545:Cdh6 UTSW 15 13041149 missense probably damaging 1.00
R6360:Cdh6 UTSW 15 13041460 missense possibly damaging 0.82
R6650:Cdh6 UTSW 15 13051401 missense probably benign 0.11
R6830:Cdh6 UTSW 15 13044774 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCCAGTTCTTCCTAAGTCCAGTG -3'
(R):5'- ACATCCTCTTATGCCACATGCCAG -3'

Sequencing Primer
(F):5'- CCAGTGATTTTGACAACAGTGCC -3'
(R):5'- TCCTTCAGTAGAAAGGCTGCG -3'
Posted On2014-01-29