Incidental Mutation 'R1240:Grk2'
ID151968
Institutional Source Beutler Lab
Gene Symbol Grk2
Ensembl Gene ENSMUSG00000024858
Gene NameG protein-coupled receptor kinase 2
SynonymsAdrbk-1, beta-adrenergic receptor kinase-1, beta-AR kinase-1, Bark-1, beta ARK, beta ARK1, betaARK1, Adrbk1
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1240 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4286001-4306222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4290679 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 251 (C251R)
Ref Sequence ENSEMBL: ENSMUSP00000126930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000167511] [ENSMUST00000171123]
Predicted Effect probably damaging
Transcript: ENSMUST00000025791
AA Change: C209R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858
AA Change: C209R

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088737
AA Change: C251R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858
AA Change: C251R

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164427
Predicted Effect probably benign
Transcript: ENSMUST00000165954
SMART Domains Protein: ENSMUSP00000128177
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:Pkinase 1 169 5.8e-46 PFAM
Pfam:Pkinase_Tyr 2 155 9.3e-20 PFAM
S_TK_X 170 208 3.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167172
Predicted Effect probably benign
Transcript: ENSMUST00000167511
SMART Domains Protein: ENSMUSP00000129839
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:RGS 74 134 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168594
SMART Domains Protein: ENSMUSP00000126025
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Blast:S_TKc 2 38 2e-18 BLAST
S_TK_X 39 85 2.95e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169991
Predicted Effect probably damaging
Transcript: ENSMUST00000171123
AA Change: C251R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858
AA Change: C251R

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene phosphorylates the beta-2-adrenergic receptor and appears to mediate agonist-specific desensitization observed at high agonist concentrations. This protein is an ubiquitous cytosolic enzyme that specifically phosphorylates the activated form of the beta-adrenergic and related G-protein-coupled receptors. Abnormal coupling of beta-adrenergic receptor to G protein is involved in the pathogenesis of the failing heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality likely due to heart failure. Homozygous mutant embryos are pale in appearance and exhibit ventricular hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Grk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Grk2 APN 19 4289311 critical splice donor site probably null
IGL00927:Grk2 APN 19 4287954 missense probably benign 0.09
IGL01465:Grk2 APN 19 4290858 missense probably damaging 1.00
IGL02692:Grk2 APN 19 4290688 splice site probably benign
IGL02870:Grk2 APN 19 4290402 missense probably damaging 1.00
IGL03210:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03227:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03230:Grk2 APN 19 4287829 missense probably benign 0.01
R0008:Grk2 UTSW 19 4287234 missense probably damaging 0.99
R0371:Grk2 UTSW 19 4291586 splice site probably null
R0426:Grk2 UTSW 19 4290600 unclassified probably null
R0494:Grk2 UTSW 19 4291319 missense probably damaging 1.00
R0833:Grk2 UTSW 19 4289357 missense probably damaging 1.00
R1446:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R1499:Grk2 UTSW 19 4287194 missense probably benign 0.11
R1664:Grk2 UTSW 19 4287240 missense possibly damaging 0.48
R1796:Grk2 UTSW 19 4287940 missense probably benign 0.12
R1803:Grk2 UTSW 19 4294883 missense probably damaging 1.00
R2021:Grk2 UTSW 19 4290670 missense probably damaging 1.00
R3947:Grk2 UTSW 19 4292417 missense possibly damaging 0.95
R4551:Grk2 UTSW 19 4286056 missense possibly damaging 0.96
R4945:Grk2 UTSW 19 4290447 missense probably damaging 1.00
R5299:Grk2 UTSW 19 4292771 missense probably damaging 1.00
R5753:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5754:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5973:Grk2 UTSW 19 4287897 missense possibly damaging 0.88
R6026:Grk2 UTSW 19 4290783 missense probably damaging 0.99
X0009:Grk2 UTSW 19 4291589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCCATGCTGAGACAGGTGGTAG -3'
(R):5'- TGCGCTCTCTAAAGCACTGGTTG -3'

Sequencing Primer
(F):5'- CAGGTGGTAGTGCAGGTCC -3'
(R):5'- CTAAAGCACTGGTTGTGTCAC -3'
Posted On2014-01-29