Mutagenetix > Incidental Mutation

Incidental Mutation 'R1243:Disp2'

152056

Institutional Source

Beutler Lab

Gene Symbol

Disp2

Ensembl Gene

ENSMUSG00000040035

Gene Name

dispatched RND transporter family member 2

Synonyms

B230210L08Rik, DispB

MMRRC Submission

039310-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R1243 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118610183-118625656 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 118622303 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1012 (R1012C)

Ref Sequence

ENSEMBL: ENSMUSP00000037136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]

AlphaFold

Q8CIP5

Predicted Effect

probably damaging
Transcript: ENSMUST00000037547
AA Change: R1012C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: R1012C

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC
Pfam:MMPL	435	635	9.7e-8	PFAM
Pfam:Sterol-sensing	458	611	9.1e-9	PFAM
transmembrane domain	657	679	N/A	INTRINSIC
low complexity region	682	695	N/A	INTRINSIC
low complexity region	748	761	N/A	INTRINSIC
transmembrane domain	914	936	N/A	INTRINSIC
transmembrane domain	943	965	N/A	INTRINSIC
transmembrane domain	975	997	N/A	INTRINSIC
transmembrane domain	1018	1040	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063975

SMART Domains

Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110843

SMART Domains

Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110846

SMART Domains

Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142072

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ajm1	C	T	2: 25,468,570 (GRCm39)	R447Q	possibly damaging	Het
Casp8ap2	A	G	4: 32,645,687 (GRCm39)	S1587G	probably benign	Het
Cyp24a1	T	C	2: 170,337,326 (GRCm39)	E154G	probably benign	Het
Dync2h1	A	G	9: 7,120,882 (GRCm39)	L2135P	probably benign	Het
Epb41l2	A	G	10: 25,364,941 (GRCm39)	R578G	possibly damaging	Het
Mus81	G	C	19: 5,535,145 (GRCm39)	R295G	probably benign	Het
Myh3	T	C	11: 66,981,279 (GRCm39)	I714T	possibly damaging	Het
Myof	A	G	19: 37,924,540 (GRCm39)	L1251P	probably damaging	Het
Nos1	A	G	5: 118,043,537 (GRCm39)	Y604C	probably damaging	Het
Or5ak22	T	C	2: 85,230,617 (GRCm39)	S87G	probably benign	Het
Pappa2	T	A	1: 158,672,670 (GRCm39)	Q1091L	probably damaging	Het
Pdia4	C	T	6: 47,784,054 (GRCm39)	D117N	probably damaging	Het
Relch	T	C	1: 105,678,089 (GRCm39)	L1114P	probably damaging	Het
Slc34a1	G	A	13: 55,559,944 (GRCm39)	A304T	possibly damaging	Het
Vmn2r98	A	T	17: 19,286,210 (GRCm39)	E236V	possibly damaging	Het
Zfp956	A	G	6: 47,932,985 (GRCm39)	T87A	probably damaging	Het

Other mutations in Disp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Disp2	APN	2	118,616,759 (GRCm39)	missense	probably damaging	1.00
IGL00970:Disp2	APN	2	118,622,274 (GRCm39)	missense	probably damaging	1.00
IGL01790:Disp2	APN	2	118,621,361 (GRCm39)	missense	probably damaging	1.00
IGL01809:Disp2	APN	2	118,617,745 (GRCm39)	splice site	probably benign
IGL02069:Disp2	APN	2	118,621,161 (GRCm39)	missense	possibly damaging	0.93
IGL02140:Disp2	APN	2	118,621,350 (GRCm39)	missense	probably benign
IGL02143:Disp2	APN	2	118,620,450 (GRCm39)	missense	probably damaging	1.00
IGL02155:Disp2	APN	2	118,622,285 (GRCm39)	missense	probably damaging	1.00
IGL02884:Disp2	APN	2	118,618,032 (GRCm39)	splice site	probably benign
IGL03113:Disp2	APN	2	118,621,259 (GRCm39)	splice site	probably null
IGL03194:Disp2	APN	2	118,618,110 (GRCm39)	missense	probably damaging	1.00
PIT4453001:Disp2	UTSW	2	118,618,125 (GRCm39)	missense	probably benign	0.01
R0109:Disp2	UTSW	2	118,622,297 (GRCm39)	missense	probably damaging	1.00
R0126:Disp2	UTSW	2	118,620,819 (GRCm39)	missense	probably damaging	1.00
R0603:Disp2	UTSW	2	118,622,487 (GRCm39)	missense	probably damaging	1.00
R0610:Disp2	UTSW	2	118,622,717 (GRCm39)	missense	probably benign	0.02
R0639:Disp2	UTSW	2	118,621,325 (GRCm39)	missense	possibly damaging	0.74
R0673:Disp2	UTSW	2	118,621,325 (GRCm39)	missense	possibly damaging	0.74
R0755:Disp2	UTSW	2	118,620,243 (GRCm39)	missense	probably benign	0.00
R0781:Disp2	UTSW	2	118,620,920 (GRCm39)	missense	probably damaging	1.00
R1110:Disp2	UTSW	2	118,620,920 (GRCm39)	missense	probably damaging	1.00
R1148:Disp2	UTSW	2	118,636,899 (GRCm39)	critical splice donor site	probably null
R1148:Disp2	UTSW	2	118,636,899 (GRCm39)	critical splice donor site	probably null
R1587:Disp2	UTSW	2	118,622,064 (GRCm39)	missense	probably damaging	1.00
R1739:Disp2	UTSW	2	118,622,031 (GRCm39)	missense	probably damaging	1.00
R1771:Disp2	UTSW	2	118,621,778 (GRCm39)	nonsense	probably null
R1781:Disp2	UTSW	2	118,623,042 (GRCm39)	missense	probably damaging	0.96
R1918:Disp2	UTSW	2	118,622,408 (GRCm39)	missense	probably benign
R1956:Disp2	UTSW	2	118,622,704 (GRCm39)	missense	probably benign	0.02
R2167:Disp2	UTSW	2	118,622,166 (GRCm39)	missense	probably damaging	1.00
R2206:Disp2	UTSW	2	118,622,725 (GRCm39)	missense	probably benign	0.02
R4031:Disp2	UTSW	2	118,622,361 (GRCm39)	missense	probably benign	0.27
R4617:Disp2	UTSW	2	118,620,643 (GRCm39)	missense	probably benign
R4656:Disp2	UTSW	2	118,621,044 (GRCm39)	missense	probably damaging	1.00
R4684:Disp2	UTSW	2	118,623,237 (GRCm39)	missense	probably damaging	1.00
R4696:Disp2	UTSW	2	118,622,165 (GRCm39)	nonsense	probably null
R4697:Disp2	UTSW	2	118,622,165 (GRCm39)	nonsense	probably null
R4738:Disp2	UTSW	2	118,620,807 (GRCm39)	missense	probably damaging	0.97
R4834:Disp2	UTSW	2	118,622,985 (GRCm39)	missense	probably benign	0.09
R4914:Disp2	UTSW	2	118,620,935 (GRCm39)	missense	probably damaging	0.99
R4915:Disp2	UTSW	2	118,620,935 (GRCm39)	missense	probably damaging	0.99
R4918:Disp2	UTSW	2	118,620,935 (GRCm39)	missense	probably damaging	0.99
R5045:Disp2	UTSW	2	118,622,543 (GRCm39)	missense	probably benign	0.03
R5208:Disp2	UTSW	2	118,622,286 (GRCm39)	missense	probably damaging	1.00
R5303:Disp2	UTSW	2	118,641,329 (GRCm39)	unclassified	probably benign
R5350:Disp2	UTSW	2	118,618,056 (GRCm39)	missense	probably benign	0.23
R5355:Disp2	UTSW	2	118,617,392 (GRCm39)	missense	probably benign	0.00
R6011:Disp2	UTSW	2	118,621,301 (GRCm39)	missense	possibly damaging	0.65
R6031:Disp2	UTSW	2	118,620,275 (GRCm39)	missense	probably benign	0.01
R6031:Disp2	UTSW	2	118,620,275 (GRCm39)	missense	probably benign	0.01
R6139:Disp2	UTSW	2	118,621,143 (GRCm39)	missense	probably damaging	0.97
R6169:Disp2	UTSW	2	118,622,031 (GRCm39)	missense	probably damaging	1.00
R6187:Disp2	UTSW	2	118,622,624 (GRCm39)	missense	probably damaging	1.00
R6209:Disp2	UTSW	2	118,617,402 (GRCm39)	missense	probably damaging	1.00
R6250:Disp2	UTSW	2	118,621,247 (GRCm39)	missense	probably damaging	1.00
R6392:Disp2	UTSW	2	118,621,230 (GRCm39)	missense	probably damaging	1.00
R7138:Disp2	UTSW	2	118,617,361 (GRCm39)	missense	probably benign
R7156:Disp2	UTSW	2	118,622,292 (GRCm39)	missense	probably damaging	1.00
R7230:Disp2	UTSW	2	118,622,286 (GRCm39)	missense	probably damaging	1.00
R7400:Disp2	UTSW	2	118,622,367 (GRCm39)	missense	probably damaging	1.00
R7460:Disp2	UTSW	2	118,620,261 (GRCm39)	missense	probably damaging	1.00
R7505:Disp2	UTSW	2	118,621,569 (GRCm39)	missense	probably damaging	1.00
R7542:Disp2	UTSW	2	118,621,599 (GRCm39)	missense	probably damaging	0.97
R7728:Disp2	UTSW	2	118,621,961 (GRCm39)	missense	probably benign	0.31
R7757:Disp2	UTSW	2	118,621,391 (GRCm39)	missense	probably damaging	1.00
R7798:Disp2	UTSW	2	118,622,360 (GRCm39)	missense	probably benign
R7945:Disp2	UTSW	2	118,623,270 (GRCm39)	missense	probably damaging	1.00
R8013:Disp2	UTSW	2	118,620,163 (GRCm39)	nonsense	probably null
R8085:Disp2	UTSW	2	118,617,452 (GRCm39)	missense	possibly damaging	0.94
R8179:Disp2	UTSW	2	118,623,030 (GRCm39)	missense	probably damaging	0.99
R8288:Disp2	UTSW	2	118,620,762 (GRCm39)	missense	probably damaging	1.00
R8345:Disp2	UTSW	2	118,641,284 (GRCm39)	missense	unknown
R8385:Disp2	UTSW	2	118,620,891 (GRCm39)	missense	probably damaging	1.00
R8700:Disp2	UTSW	2	118,620,340 (GRCm39)	nonsense	probably null
R8808:Disp2	UTSW	2	118,620,489 (GRCm39)	missense	probably damaging	1.00
R8880:Disp2	UTSW	2	118,621,239 (GRCm39)	missense	probably damaging	1.00
R8997:Disp2	UTSW	2	118,617,467 (GRCm39)	missense	probably damaging	1.00
R9022:Disp2	UTSW	2	118,621,179 (GRCm39)	missense	probably benign	0.22
R9181:Disp2	UTSW	2	118,617,393 (GRCm39)	missense	probably benign	0.08
R9660:Disp2	UTSW	2	118,620,627 (GRCm39)	missense	probably benign
Z1177:Disp2	UTSW	2	118,621,308 (GRCm39)	missense	probably damaging	1.00
Z1177:Disp2	UTSW	2	118,620,183 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAACCGAGATGAGCAAGGCAC -3'
(R):5'- TTCTGGCCCGAAGAAACAGCAC -3'

Sequencing Primer
(F):5'- TGTACAGCTTGCAGCATAGTC -3'
(R):5'- ACAGCACAGGGACTGAAAG -3'

Posted On

2014-01-29