Incidental Mutation 'R1244:Tbc1d17'
ID152084
Institutional Source Beutler Lab
Gene Symbol Tbc1d17
Ensembl Gene ENSMUSG00000038520
Gene NameTBC1 domain family, member 17
Synonyms
MMRRC Submission 039311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1244 (G1)
Quality Score197
Status Not validated
Chromosome7
Chromosomal Location44834623-44849079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44844398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 267 (V267E)
Ref Sequence ENSEMBL: ENSMUSP00000121546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000054343] [ENSMUST00000107885] [ENSMUST00000118125] [ENSMUST00000145959] [ENSMUST00000207293] [ENSMUST00000207532]
Predicted Effect probably benign
Transcript: ENSMUST00000033015
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047085
AA Change: V267E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520
AA Change: V267E

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054343
SMART Domains Protein: ENSMUSP00000049764
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107885
SMART Domains Protein: ENSMUSP00000103517
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 104 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
Pfam:PRAS 199 323 1.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142098
Predicted Effect probably benign
Transcript: ENSMUST00000142880
Predicted Effect probably damaging
Transcript: ENSMUST00000145959
AA Change: V267E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520
AA Change: V267E

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153161
Predicted Effect probably benign
Transcript: ENSMUST00000207293
Predicted Effect probably benign
Transcript: ENSMUST00000207532
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,216,144 T1417I probably benign Het
Abca14 G A 7: 120,216,338 A270T probably benign Het
Ash2l T C 8: 25,817,421 S529G probably damaging Het
Atp13a3 T C 16: 30,361,836 Y125C probably benign Het
Btbd11 C A 10: 85,387,363 T12K unknown Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cct4 A G 11: 22,996,417 E131G probably benign Het
Cd84 A G 1: 171,851,830 D25G probably damaging Het
Chd9 A G 8: 91,022,929 D1728G probably damaging Het
Cyp39a1 A T 17: 43,749,945 K461N probably benign Het
Ddx50 T A 10: 62,642,924 Q161L probably damaging Het
Golga5 A G 12: 102,472,295 T90A probably benign Het
Heatr3 A G 8: 88,141,739 E39G possibly damaging Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il10 A G 1: 131,024,216 D162G probably damaging Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ogfod1 A G 8: 94,037,371 D28G probably benign Het
Olfr1436 A T 19: 12,298,496 I212N probably damaging Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Scn2a T C 2: 65,763,655 I1616T probably damaging Het
Sipa1l1 A G 12: 82,425,416 N1390S probably benign Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r77 A T 7: 12,041,920 T140S possibly damaging Het
Vmn2r15 A T 5: 109,293,226 Y255* probably null Het
Other mutations in Tbc1d17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Tbc1d17 APN 7 44843085 missense probably benign 0.00
IGL00791:Tbc1d17 APN 7 44845313 missense probably benign 0.04
IGL01865:Tbc1d17 APN 7 44842689 missense possibly damaging 0.90
IGL02468:Tbc1d17 APN 7 44848329 missense probably benign
IGL02829:Tbc1d17 APN 7 44848872 unclassified probably benign
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0414:Tbc1d17 UTSW 7 44846059 missense probably benign 0.00
R0574:Tbc1d17 UTSW 7 44843123 unclassified probably benign
R0626:Tbc1d17 UTSW 7 44843085 missense probably benign 0.00
R0960:Tbc1d17 UTSW 7 44848428 splice site probably benign
R1203:Tbc1d17 UTSW 7 44843471 missense probably damaging 1.00
R1730:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1783:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1899:Tbc1d17 UTSW 7 44841633 unclassified probably benign
R1953:Tbc1d17 UTSW 7 44841398 unclassified probably null
R2106:Tbc1d17 UTSW 7 44848268 critical splice donor site probably null
R3889:Tbc1d17 UTSW 7 44845938 missense probably damaging 1.00
R4240:Tbc1d17 UTSW 7 44846826 missense probably damaging 1.00
R4547:Tbc1d17 UTSW 7 44841347 missense probably benign
R4787:Tbc1d17 UTSW 7 44843064 missense probably benign 0.02
R5422:Tbc1d17 UTSW 7 44848868 start codon destroyed probably null 0.98
R5569:Tbc1d17 UTSW 7 44848331 missense probably damaging 1.00
R5933:Tbc1d17 UTSW 7 44845337 missense probably damaging 0.96
R6502:Tbc1d17 UTSW 7 44841625 missense probably benign 0.30
R6838:Tbc1d17 UTSW 7 44844314 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAAGGAACTTCCAAGCCTCTCGAC -3'
(R):5'- TTCCTAGCCTGGCCTTAGAGTGTG -3'

Sequencing Primer
(F):5'- CAACAGTCAGAGGGCTTCC -3'
(R):5'- GCCTTAGAGTGTGTGACCCTC -3'
Posted On2014-01-29