Incidental Mutation 'R1245:Gm5828'
ID152108
Institutional Source Beutler Lab
Gene Symbol Gm5828
Ensembl Gene ENSMUSG00000091020
Gene Namepredicted gene 5828
Synonyms
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location16768279-16770138 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 16769129 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000071842
SMART Domains Protein: ENSMUSP00000136559
Gene: ENSMUSG00000091020

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 174 182 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.88e-17 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 481 N/A INTRINSIC
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Gm5828
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gm5828 APN 1 16769948 exon noncoding transcript
IGL01751:Gm5828 APN 1 16769984 exon noncoding transcript
IGL02275:Gm5828 APN 1 16769118 exon noncoding transcript
IGL02400:Gm5828 APN 1 16769818 exon noncoding transcript
IGL02480:Gm5828 APN 1 16769542 exon noncoding transcript
R0143:Gm5828 UTSW 1 16768355 exon noncoding transcript
R1405:Gm5828 UTSW 1 16769544 exon noncoding transcript
R1514:Gm5828 UTSW 1 16769359 exon noncoding transcript
R1644:Gm5828 UTSW 1 16769261 exon noncoding transcript
R2118:Gm5828 UTSW 1 16769975 exon noncoding transcript
R2290:Gm5828 UTSW 1 16768344 exon noncoding transcript
R3428:Gm5828 UTSW 1 16768614 exon noncoding transcript
R3962:Gm5828 UTSW 1 16768644 exon noncoding transcript
R4657:Gm5828 UTSW 1 16769418 exon noncoding transcript
R5067:Gm5828 UTSW 1 16769292 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCACTGTGCCTGGGATAACAGTAAC -3'
(R):5'- ATACACAGGCTGCCATCAAGGGAC -3'

Sequencing Primer
(F):5'- TGCCTGGGATAACAGTAACCATTC -3'
(R):5'- CCGAATGCAACCTTTGGG -3'
Posted On2014-01-29