Incidental Mutation 'R1245:Ncs1'
ID152112
Institutional Source Beutler Lab
Gene Symbol Ncs1
Ensembl Gene ENSMUSG00000062661
Gene Nameneuronal calcium sensor 1
Synonyms9430075O15Rik, Freq, NCS-1, A730032G13Rik
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31245823-31295989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31284693 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 143 (N143S)
Ref Sequence ENSEMBL: ENSMUSP00000000199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000199] [ENSMUST00000150670]
Predicted Effect probably benign
Transcript: ENSMUST00000000199
AA Change: N143S

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000199
Gene: ENSMUSG00000062661
AA Change: N143S

DomainStartEndE-ValueType
EFh 64 92 1.9e-2 SMART
EFh 100 128 3.76e-6 SMART
EFh 148 176 3.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150670
SMART Domains Protein: ENSMUSP00000142269
Gene: ENSMUSG00000062661

DomainStartEndE-ValueType
PDB:4OV2|D 1 28 6e-8 PDB
SCOP:d1fpwa_ 1 28 1e-4 SMART
low complexity region 37 57 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Ncs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ncs1 APN 2 31284165 missense probably damaging 1.00
R2853:Ncs1 UTSW 2 31287317 missense probably damaging 0.98
R2983:Ncs1 UTSW 2 31284696 missense probably damaging 1.00
R5474:Ncs1 UTSW 2 31280784 missense probably damaging 1.00
R5813:Ncs1 UTSW 2 31280654 splice site probably null
R6662:Ncs1 UTSW 2 31287360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCAGGAACGAGATGCTCGAC -3'
(R):5'- CACCAAAGACCCTGAATGGCTACTG -3'

Sequencing Primer
(F):5'- TAGTGGACGCCATTTACCAG -3'
(R):5'- TACTGGCTGCGAGTCAAG -3'
Posted On2014-01-29