Incidental Mutation 'R1245:Olfr1122'
ID152114
Institutional Source Beutler Lab
Gene Symbol Olfr1122
Ensembl Gene ENSMUSG00000047594
Gene Nameolfactory receptor 1122
SynonymsGA_x6K02T2Q125-48880078-48881058, MOR264-1
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87385849-87391930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87388209 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 168 (V168E)
Ref Sequence ENSEMBL: ENSMUSP00000149403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056435] [ENSMUST00000215371]
Predicted Effect probably benign
Transcript: ENSMUST00000056435
AA Change: V168E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000052190
Gene: ENSMUSG00000047594
AA Change: V168E

DomainStartEndE-ValueType
Pfam:7tm_4 43 319 6.3e-51 PFAM
Pfam:7tm_1 53 302 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215371
AA Change: V168E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Olfr1122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1122 APN 2 87387843 missense possibly damaging 0.91
IGL01783:Olfr1122 APN 2 87387838 missense probably benign 0.39
IGL02396:Olfr1122 APN 2 87387705 utr 5 prime probably benign
IGL03338:Olfr1122 APN 2 87388126 missense probably benign 0.05
IGL03373:Olfr1122 APN 2 87388233 missense probably damaging 1.00
R0594:Olfr1122 UTSW 2 87387954 missense probably damaging 1.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1471:Olfr1122 UTSW 2 87388518 missense probably damaging 1.00
R1681:Olfr1122 UTSW 2 87388620 missense possibly damaging 0.95
R1995:Olfr1122 UTSW 2 87387831 missense probably damaging 0.97
R2246:Olfr1122 UTSW 2 87387851 missense probably benign 0.00
R2341:Olfr1122 UTSW 2 87387740 missense probably benign
R4008:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4009:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4011:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4119:Olfr1122 UTSW 2 87387843 missense possibly damaging 0.91
R4547:Olfr1122 UTSW 2 87388160 missense probably benign 0.07
R4665:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4666:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4801:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R4802:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R5049:Olfr1122 UTSW 2 87388658 missense probably benign 0.00
R5070:Olfr1122 UTSW 2 87388163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATCCCAAGGATGCTCATGGAC -3'
(R):5'- AGGCTTTAGACCTCCCTCCAGATG -3'

Sequencing Primer
(F):5'- AAGGATGCTCATGGACCTTTG -3'
(R):5'- CGTTGCAGATAATCTTGCCATAGG -3'
Posted On2014-01-29