Incidental Mutation 'R1245:Zscan29'
ID152115
Institutional Source Beutler Lab
Gene Symbol Zscan29
Ensembl Gene ENSMUSG00000050619
Gene Namezinc finger SCAN domains 29
SynonymsZfp690
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121158273-121171125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121166503 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Ref Sequence ENSEMBL: ENSMUSP00000078033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000079024] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000110661] [ENSMUST00000146243] [ENSMUST00000163766] [ENSMUST00000186659]
Predicted Effect probably benign
Transcript: ENSMUST00000039541
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079024
AA Change: T246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619
AA Change: T246A

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110657
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110658
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110661
AA Change: T246A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619
AA Change: T246A

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144123
Predicted Effect silent
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156370
Predicted Effect probably damaging
Transcript: ENSMUST00000163766
AA Change: T246A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619
AA Change: T246A

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186659
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Other mutations in Zscan29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zscan29 APN 2 121170057 missense probably damaging 1.00
IGL01938:Zscan29 APN 2 121166209 missense probably benign 0.16
IGL02220:Zscan29 APN 2 121166689 missense probably damaging 0.99
IGL02370:Zscan29 APN 2 121163833 missense probably benign 0.00
IGL02585:Zscan29 APN 2 121163876 nonsense probably null
R0284:Zscan29 UTSW 2 121166733 unclassified probably benign
R0842:Zscan29 UTSW 2 121161479 missense possibly damaging 0.84
R1586:Zscan29 UTSW 2 121161160 missense probably damaging 1.00
R1654:Zscan29 UTSW 2 121164779 missense probably benign 0.06
R1958:Zscan29 UTSW 2 121169808 critical splice donor site probably null
R2073:Zscan29 UTSW 2 121160855 nonsense probably null
R2085:Zscan29 UTSW 2 121169946 nonsense probably null
R2145:Zscan29 UTSW 2 121170106 missense probably damaging 1.00
R2201:Zscan29 UTSW 2 121169402 missense probably damaging 1.00
R2875:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R2876:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R3861:Zscan29 UTSW 2 121160731 missense probably benign 0.01
R4244:Zscan29 UTSW 2 121164794 unclassified probably null
R4245:Zscan29 UTSW 2 121164794 unclassified probably null
R4447:Zscan29 UTSW 2 121169886 unclassified probably null
R4662:Zscan29 UTSW 2 121166615 missense probably benign 0.26
R4757:Zscan29 UTSW 2 121160911 missense possibly damaging 0.92
R4777:Zscan29 UTSW 2 121169324 missense probably damaging 0.96
R4905:Zscan29 UTSW 2 121161383 missense possibly damaging 0.53
R4970:Zscan29 UTSW 2 121169195 splice site probably null
R5860:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5861:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5862:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5916:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5917:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5918:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R6335:Zscan29 UTSW 2 121161436 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATGACCAAGCTGGTAAGTGGTTCC -3'
(R):5'- AATGTGGTGTCCAGGTTGGATCAAG -3'

Sequencing Primer
(F):5'- TGAAATGACCTGGGCACTC -3'
(R):5'- TCCAGGTTGGATCAAGGAGAG -3'
Posted On2014-01-29