Incidental Mutation 'R1245:Lmcd1'
ID152123
Institutional Source Beutler Lab
Gene Symbol Lmcd1
Ensembl Gene ENSMUSG00000057604
Gene NameLIM and cysteine-rich domains 1
Synonymsdyxin
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location112273758-112330425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112315712 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 175 (V175E)
Ref Sequence ENSEMBL: ENSMUSP00000032376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032376]
Predicted Effect probably benign
Transcript: ENSMUST00000032376
AA Change: V175E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000032376
Gene: ENSMUSG00000057604
AA Change: V175E

DomainStartEndE-ValueType
Pfam:PET 107 201 4.9e-39 PFAM
LIM 242 299 7.29e-8 SMART
LIM 307 359 1.97e-13 SMART
Meta Mutation Damage Score 0.1664 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM-domain family of zinc finger proteins. The encoded protein contains an N-terminal cysteine-rich domain and two C-terminal LIM domains. The presence of LIM domains suggests involvement in protein-protein interactions. The protein may act as a co-regulator of transcription along with other transcription factors. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Lmcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lmcd1 APN 6 112329808 missense probably benign 0.29
IGL00963:Lmcd1 APN 6 112329934 missense probably damaging 1.00
IGL01339:Lmcd1 APN 6 112310625 missense probably benign
IGL01373:Lmcd1 APN 6 112310625 missense probably benign
IGL03088:Lmcd1 APN 6 112310688 missense probably damaging 1.00
IGL03090:Lmcd1 APN 6 112310499 missense probably benign 0.32
R0940:Lmcd1 UTSW 6 112328697 missense probably benign 0.01
R1144:Lmcd1 UTSW 6 112310751 splice site probably benign
R1338:Lmcd1 UTSW 6 112305128 missense probably damaging 1.00
R1567:Lmcd1 UTSW 6 112310565 missense probably damaging 1.00
R1615:Lmcd1 UTSW 6 112273950 missense probably benign 0.40
R1748:Lmcd1 UTSW 6 112329914 missense probably benign 0.01
R1793:Lmcd1 UTSW 6 112328751 missense probably benign 0.00
R2014:Lmcd1 UTSW 6 112328741 missense probably damaging 1.00
R2042:Lmcd1 UTSW 6 112315890 missense probably benign 0.00
R4322:Lmcd1 UTSW 6 112315763 missense possibly damaging 0.54
R4344:Lmcd1 UTSW 6 112288007 intron probably benign
R4771:Lmcd1 UTSW 6 112315873 missense probably damaging 1.00
R4863:Lmcd1 UTSW 6 112287871 intron probably benign
R5256:Lmcd1 UTSW 6 112288126 intron probably benign
R5296:Lmcd1 UTSW 6 112315588 missense probably damaging 1.00
R6453:Lmcd1 UTSW 6 112315828 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTATGACCATGAGCAACAGCCAC -3'
(R):5'- TTTAGCCAGACCAGAGACAGGGAC -3'

Sequencing Primer
(F):5'- ACGTGACATAGTCTCTTCCAC -3'
(R):5'- TTTGGATGGATCACCCAGGC -3'
Posted On2014-01-29