Incidental Mutation 'R1245:Slc35e1'
ID152128
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1245 (G1)
Quality Score102
Status Validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 72492571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141352
SMART Domains Protein: ENSMUSP00000122215
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:EamA 5 58 1.5e-6 PFAM
Pfam:UAA 6 214 4e-8 PFAM
Pfam:TPT 67 211 1.7e-38 PFAM
Pfam:EamA 76 211 1.4e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152080
AA Change: T6A
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: T6A

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212699
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0566:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1051:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1343:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1430:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACGGGAAGGCGCTCAAAATCAC -3'
(R):5'- GGGAAATTGACACCTACCGCACAG -3'

Sequencing Primer
(F):5'- GCGCTCAAAATCACCTTGTTG -3'
(R):5'- GCGTAGTCCAGAGGATTTACC -3'
Posted On2014-01-29