Incidental Mutation 'R1245:Zfp653'
ID152129
Institutional Source Beutler Lab
Gene Symbol Zfp653
Ensembl Gene ENSMUSG00000038895
Gene Namezinc finger protein 653
Synonyms
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22055411-22071376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22056422 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 529 (I529N)
Ref Sequence ENSEMBL: ENSMUSP00000137064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003501] [ENSMUST00000043922] [ENSMUST00000179605] [ENSMUST00000215901]
Predicted Effect probably benign
Transcript: ENSMUST00000003501
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043922
AA Change: I521N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895
AA Change: I521N

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179605
AA Change: I529N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895
AA Change: I529N

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect probably benign
Transcript: ENSMUST00000215901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216916
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Zfp653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02541:Zfp653 APN 9 22055783 missense probably damaging 1.00
R1473:Zfp653 UTSW 9 22058220 missense possibly damaging 0.92
R1564:Zfp653 UTSW 9 22055859 missense probably damaging 1.00
R1574:Zfp653 UTSW 9 22057978 nonsense probably null
R1574:Zfp653 UTSW 9 22057978 nonsense probably null
R2851:Zfp653 UTSW 9 22057566 missense probably benign 0.09
R2852:Zfp653 UTSW 9 22057566 missense probably benign 0.09
R2967:Zfp653 UTSW 9 22065730 missense probably damaging 1.00
R4937:Zfp653 UTSW 9 22055778 missense probably damaging 1.00
R5390:Zfp653 UTSW 9 22057803 critical splice donor site probably null
R6135:Zfp653 UTSW 9 22058262 missense probably damaging 0.97
R6798:Zfp653 UTSW 9 22057372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGACTCGTGTCGGGACTCAGG -3'
(R):5'- GCTGGACACTAGGATGCCTCTTTC -3'

Sequencing Primer
(F):5'- TGTCGGGACTCAGGACAAC -3'
(R):5'- ATGGCTTATGTCCTGGCTAC -3'
Posted On2014-01-29