Incidental Mutation 'R1245:Ibtk'
ID152130
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Nameinhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms5430411K16Rik
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85687360-85749334 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 85720742 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
Predicted Effect probably null
Transcript: ENSMUST00000039213
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186322
Predicted Effect probably benign
Transcript: ENSMUST00000187521
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188768
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85717545 splice site probably null
IGL00852:Ibtk APN 9 85713601 missense probably benign 0.01
IGL00907:Ibtk APN 9 85690331 missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85732622 splice site probably benign
IGL02125:Ibtk APN 9 85735070 missense probably damaging 1.00
IGL02214:Ibtk APN 9 85714179
IGL02223:Ibtk APN 9 85710366
IGL02638:Ibtk APN 9 85719893 missense probably damaging 1.00
IGL02741:Ibtk APN 9 85726612 missense probably damaging 1.00
IGL03299:Ibtk APN 9 85721136 missense probably benign 0.27
IGL03493:Ibtk APN 9 85718919 missense probably benign 0.44
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0558:Ibtk UTSW 9 85737538 missense probably damaging 0.99
R0569:Ibtk UTSW 9 85708181 splice site probably benign
R0932:Ibtk UTSW 9 85735046 missense probably damaging 1.00
R0973:Ibtk UTSW 9 85743577 missense probably damaging 1.00
R1237:Ibtk UTSW 9 85720748 missense probably benign 0.00
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1921:Ibtk UTSW 9 85703082 missense probably benign
R2090:Ibtk UTSW 9 85720993 missense probably benign 0.01
R2109:Ibtk UTSW 9 85706550 missense probably benign
R2277:Ibtk UTSW 9 85703151 missense probably benign
R2437:Ibtk UTSW 9 85708125 missense probably benign 0.27
R2446:Ibtk UTSW 9 85703073 missense probably benign 0.22
R3107:Ibtk UTSW 9 85710414 missense probably damaging 1.00
R3876:Ibtk UTSW 9 85718426 missense probably benign 0.06
R4160:Ibtk UTSW 9 85703090 missense probably benign 0.01
R4273:Ibtk UTSW 9 85726731 missense probably damaging 1.00
R4321:Ibtk UTSW 9 85735072 missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85728554 missense probably benign 0.04
R4947:Ibtk UTSW 9 85710412 missense probably benign 0.00
R5228:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5268:Ibtk UTSW 9 85743690 missense probably benign 0.00
R5327:Ibtk UTSW 9 85737466 critical splice donor site probably null
R5344:Ibtk UTSW 9 85735004 missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5502:Ibtk UTSW 9 85720863 missense probably benign 0.13
R5756:Ibtk UTSW 9 85731254 missense possibly damaging 0.51
X0021:Ibtk UTSW 9 85697174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCTGAGACAGAGACCTTTCCAGCAC -3'
(R):5'- TCTCATCTGCACACTGTGAATTGCC -3'

Sequencing Primer
(F):5'- GCAGCAACCTTTCTGATGAG -3'
(R):5'- CATGTGGATGATAAACAGAAGTCAGC -3'
Posted On2014-01-29