Incidental Mutation 'R1245:Adcy1'
ID152134
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Nameadenylate cyclase 1
SynonymsI-AC, D11Bwg1392e, AC1
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location7063489-7178506 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 7169410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
Predicted Effect probably benign
Transcript: ENSMUST00000020706
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135398
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7137385 missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7064102 missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7169414 missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7167143 missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7100565 splice site probably benign
IGL01945:Adcy1 APN 11 7161891 missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7144737 missense probably benign 0.26
IGL02649:Adcy1 APN 11 7167156 missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7138279 splice site probably benign
IGL02813:Adcy1 APN 11 7146591 missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7079012 missense probably benign 0.19
IGL03116:Adcy1 APN 11 7150071 missense probably benign
IGL03119:Adcy1 APN 11 7109051 missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7167054 splice site probably benign
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7149497 splice site probably benign
R0082:Adcy1 UTSW 11 7149497 splice site probably benign
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7149538 missense probably benign 0.08
R0569:Adcy1 UTSW 11 7146514 missense probably benign 0.34
R1055:Adcy1 UTSW 11 7109075 missense probably damaging 1.00
R1144:Adcy1 UTSW 11 7137400 missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7167054 splice site probably null
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1823:Adcy1 UTSW 11 7161312 missense probably benign 0.23
R1953:Adcy1 UTSW 11 7078991 missense probably benign 0.01
R1957:Adcy1 UTSW 11 7161945 missense probably benign 0.00
R2029:Adcy1 UTSW 11 7139142 missense probably benign 0.10
R2051:Adcy1 UTSW 11 7161885 nonsense probably null
R2483:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3108:Adcy1 UTSW 11 7169453 missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3624:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R4082:Adcy1 UTSW 11 7064117 missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7063889 missense probably damaging 1.00
R4470:Adcy1 UTSW 11 7144804 missense probably benign 0.17
R4472:Adcy1 UTSW 11 7130369 missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7138336 missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7161298 missense probably benign 0.25
R5237:Adcy1 UTSW 11 7149553 missense probably benign 0.00
R5288:Adcy1 UTSW 11 7161351 missense probably benign 0.01
R5304:Adcy1 UTSW 11 7064198 missense probably benign 0.00
R5341:Adcy1 UTSW 11 7130375 missense probably damaging 0.99
R5379:Adcy1 UTSW 11 7146532 missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7139088 nonsense probably null
R5677:Adcy1 UTSW 11 7161914 missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7109020 missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7130300 missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7139095 missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7161337 missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7161367 missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7150884 missense possibly damaging 0.81
X0027:Adcy1 UTSW 11 7161930 missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7150019 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGATCCAGAGAGCCTGTCCATCTAC -3'
(R):5'- TCGTTCCAAGCGAAAGGTCCTG -3'

Sequencing Primer
(F):5'- TGCACTAAGCAGTCACAATGG -3'
(R):5'- CGAAAGGTCCTGCCGTG -3'
Posted On2014-01-29