Incidental Mutation 'R1245:Smg8'
ID152135
Institutional Source Beutler Lab
Gene Symbol Smg8
Ensembl Gene ENSMUSG00000020495
Gene Namesmg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms1200011M11Rik
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87077732-87086774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87083610 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 632 (D632G)
Ref Sequence ENSEMBL: ENSMUSP00000020801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020801] [ENSMUST00000143280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020801
AA Change: D632G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020801
Gene: ENSMUSG00000020495
AA Change: D632G

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Pfam:DUF2146 41 985 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120315
Predicted Effect possibly damaging
Transcript: ENSMUST00000143280
AA Change: D175G

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119011
Gene: ENSMUSG00000020495
AA Change: D175G

DomainStartEndE-ValueType
Pfam:DUF2146 1 269 2.9e-89 PFAM
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Smg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Smg8 APN 11 87078041 missense probably damaging 0.96
IGL01591:Smg8 APN 11 87085153 missense probably damaging 1.00
IGL01844:Smg8 APN 11 87080276 missense probably damaging 1.00
IGL02634:Smg8 APN 11 87086672 missense probably benign
IGL03170:Smg8 APN 11 87086608 missense probably damaging 1.00
IGL03206:Smg8 APN 11 87085988 unclassified probably null
R0218:Smg8 UTSW 11 87086122 missense probably damaging 1.00
R0378:Smg8 UTSW 11 87080423 missense probably damaging 1.00
R0497:Smg8 UTSW 11 87086084 missense possibly damaging 0.95
R0522:Smg8 UTSW 11 87086462 missense probably benign
R0546:Smg8 UTSW 11 87083613 missense possibly damaging 0.69
R0634:Smg8 UTSW 11 87086108 missense possibly damaging 0.86
R1710:Smg8 UTSW 11 87086287 missense probably damaging 0.98
R1726:Smg8 UTSW 11 87080613 nonsense probably null
R1747:Smg8 UTSW 11 87085303 missense possibly damaging 0.93
R1748:Smg8 UTSW 11 87085768 missense probably damaging 1.00
R1909:Smg8 UTSW 11 87080613 nonsense probably null
R1981:Smg8 UTSW 11 87085331 missense probably benign 0.00
R2356:Smg8 UTSW 11 87085728 missense probably benign 0.00
R4459:Smg8 UTSW 11 87085570 missense probably benign 0.09
R4724:Smg8 UTSW 11 87086221 missense probably benign 0.39
R4914:Smg8 UTSW 11 87080710 missense probably damaging 1.00
R5023:Smg8 UTSW 11 87086137 missense probably damaging 1.00
R5284:Smg8 UTSW 11 87080311 missense possibly damaging 0.94
R5368:Smg8 UTSW 11 87080260 missense probably benign 0.21
R5534:Smg8 UTSW 11 87085470 missense probably benign 0.06
R5689:Smg8 UTSW 11 87085123 missense probably damaging 0.98
R6651:Smg8 UTSW 11 87086546 missense probably benign 0.30
R6896:Smg8 UTSW 11 87077961 missense possibly damaging 0.46
X0028:Smg8 UTSW 11 87086122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGAATATAAGCACACGAATGCAAA -3'
(R):5'- GTTACACTTTCCAGGAGAAAAGCCAGA -3'

Sequencing Primer
(F):5'- cacccgactgctcttcc -3'
(R):5'- GAGGCAGATAGGAACCCTCC -3'
Posted On2014-01-29