Incidental Mutation 'R1245:Psma2'
ID152136
Institutional Source Beutler Lab
Gene Symbol Psma2
Ensembl Gene ENSMUSG00000015671
Gene Nameproteasome (prosome, macropain) subunit, alpha type 2
SynonymsLmpc3
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R1245 (G1)
Quality Score223
Status Validated
Chromosome13
Chromosomal Location14613240-14674236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14613291 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 6 (Y6C)
Ref Sequence ENSEMBL: ENSMUSP00000129767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015816] [ENSMUST00000170836] [ENSMUST00000220621] [ENSMUST00000221168] [ENSMUST00000221699]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015816
SMART Domains Protein: ENSMUSP00000015816
Gene: ENSMUSG00000015672

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 25 32 N/A INTRINSIC
Pfam:Ribosomal_L32p 78 135 7.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170836
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129767
Gene: ENSMUSG00000015671
AA Change: Y6C

DomainStartEndE-ValueType
Proteasome_A_N 6 28 1.73e-5 SMART
Pfam:Proteasome 29 213 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220621
Predicted Effect probably benign
Transcript: ENSMUST00000221168
Predicted Effect probably benign
Transcript: ENSMUST00000221699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223530
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Psma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Psma2 APN 13 14619363 missense probably damaging 0.98
IGL02001:Psma2 APN 13 14623607 missense possibly damaging 0.90
R1801:Psma2 UTSW 13 14623605 missense probably benign 0.00
R3428:Psma2 UTSW 13 14616777 missense probably benign 0.03
R4551:Psma2 UTSW 13 14616845 missense possibly damaging 0.69
R5068:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5069:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5070:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5324:Psma2 UTSW 13 14625217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGTTAAGTCCGCCCACTTC -3'
(R):5'- ACGGAACATGACTCTGCAAAGCTAC -3'

Sequencing Primer
(F):5'- CGCCTCCTCGCTCAGAG -3'
(R):5'- TCTGCAAAGCTACGAGTCCAG -3'
Posted On2014-01-29