Incidental Mutation 'R1245:Gpr137c'
ID152137
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene NameG protein-coupled receptor 137C
SynonymsLOC380893, 6330416L11Rik, TM7SF1L2
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45219717-45282725 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 45279065 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022378] [ENSMUST00000146150] [ENSMUST00000151749]
Predicted Effect probably benign
Transcript: ENSMUST00000022378
SMART Domains Protein: ENSMUSP00000022378
Gene: ENSMUSG00000021831

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:ERO1 60 453 3.7e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146150
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227166
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45278745 missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45279955 missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45277487 missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45246433 missense possibly damaging 0.92
R0731:Gpr137c UTSW 14 45246349 missense probably damaging 1.00
R1162:Gpr137c UTSW 14 45244158 missense possibly damaging 0.89
R1983:Gpr137c UTSW 14 45279971 missense probably benign 0.01
R2060:Gpr137c UTSW 14 45244159 missense probably damaging 1.00
R2428:Gpr137c UTSW 14 45278963 missense probably damaging 1.00
R3034:Gpr137c UTSW 14 45220276 missense probably damaging 0.99
R3911:Gpr137c UTSW 14 45278935 missense probably benign 0.31
R4037:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4038:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45246508 missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45246286 critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45278694 missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45277481 missense probably damaging 0.96
X0027:Gpr137c UTSW 14 45278669 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACCCAGTCTTTAATGCTGTGTCCAC -3'
(R):5'- AGCAATCCTTCCATGCCTGTCAAC -3'

Sequencing Primer
(F):5'- CTGTGTCCACAGGCACC -3'
(R):5'- ATGCTCTGACTCTGAACCGAG -3'
Posted On2014-01-29