Incidental Mutation 'R1245:Myc'
ID152138
Institutional Source Beutler Lab
Gene Symbol Myc
Ensembl Gene ENSMUSG00000022346
Gene Namemyelocytomatosis oncogene
SynonymsNird, Myc2, Niard, c-myc, bHLHe39
MMRRC Submission 039312-MU
Accession Numbers

VEGA: OTTMUSP00000048877; MGI: 97250

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1245 (G1)
Quality Score134
Status Validated
Chromosome15
Chromosomal Location61985391-61990374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61987897 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000141139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022971] [ENSMUST00000159327] [ENSMUST00000159338] [ENSMUST00000160009] [ENSMUST00000161976] [ENSMUST00000167731] [ENSMUST00000188482] [ENSMUST00000191178]
Predicted Effect probably damaging
Transcript: ENSMUST00000022971
AA Change: I141V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022971
Gene: ENSMUSG00000022346
AA Change: I141V

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 7e-118 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159327
AA Change: I126V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124758
Gene: ENSMUSG00000022346
AA Change: I126V

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159338
Predicted Effect possibly damaging
Transcript: ENSMUST00000160009
AA Change: I126V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123852
Gene: ENSMUSG00000022346
AA Change: I126V

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161976
AA Change: I126V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123821
Gene: ENSMUSG00000022346
AA Change: I126V

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167731
AA Change: I140V

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130285
Gene: ENSMUSG00000022346
AA Change: I140V

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.5e-141 PFAM
HLH 374 426 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188482
AA Change: I141V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140183
Gene: ENSMUSG00000022346
AA Change: I141V

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 1.5e-141 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191178
AA Change: I140V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141139
Gene: ENSMUSG00000022346
AA Change: I140V

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.9e-141 PFAM
HLH 374 426 2.3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192740
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma, in human. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini, in human and mouse. Under conditions of stress, such as high cell densities and methionine deprivation, there is a specific and dramatic increase in the synthesis of the non-AUG initiated protein, suggesting its importance in times of adversity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mutations affect growth and development of heart, pericardium, neural tube, vasculogenesis and erythropoeisis. Homozygous null mutants die by embryonic day 10.5. Heterozygotes have reduced body size and multiorgan hypoplasia; females have small litters. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(19) Gene trapped(4)          

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Myc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Myc APN 15 61989820 missense probably benign 0.03
IGL02372:Myc APN 15 61987858 missense probably damaging 1.00
IGL02400:Myc APN 15 61989911 unclassified probably benign
IGL02677:Myc APN 15 61989664 missense probably damaging 1.00
IGL02834:Myc APN 15 61987666 missense probably damaging 1.00
IGL03330:Myc APN 15 61988149 missense probably benign
PIT1430001:Myc UTSW 15 61987693 missense probably damaging 1.00
R2105:Myc UTSW 15 61988102 missense probably damaging 1.00
R4373:Myc UTSW 15 61989664 missense probably damaging 0.99
R6774:Myc UTSW 15 61988279 critical splice donor site probably null
R6813:Myc UTSW 15 61988152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAAATTCGAGCTGCTTCCCAC -3'
(R):5'- AAGACCACTGAGGGGTCAATGCAC -3'

Sequencing Primer
(F):5'- ATCCTATGTTGCGGTCGCT -3'
(R):5'- TCAATGCACTCGGACGC -3'
Posted On2014-01-29