Incidental Mutation 'R1245:Nckap1l'
ID152139
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103455925 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000154960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect probably damaging
Transcript: ENSMUST00000047405
AA Change: E100G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: E100G

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229127
AA Change: E100G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0137:Nckap1l UTSW 15 103481964 missense probably benign 0.01
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0412:Nckap1l UTSW 15 103464652 missense probably benign 0.01
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4270:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGAGCTATTGATCCCACCCTAGCA -3'
(R):5'- tcgtgccacTGACCATATCCACT -3'

Sequencing Primer
(F):5'- GTTCACCCCTTAAAGAATGACTGG -3'
(R):5'- GTGCCTTTATCCTTTTCTTTCAAGAA -3'
Posted On2014-01-29