Incidental Mutation 'R1245:Cblb'
ID152140
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 52047187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]
Predicted Effect probably benign
Transcript: ENSMUST00000114471
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226253
Predicted Effect probably benign
Transcript: ENSMUST00000226593
Predicted Effect probably benign
Transcript: ENSMUST00000227062
Predicted Effect probably benign
Transcript: ENSMUST00000227756
Predicted Effect probably benign
Transcript: ENSMUST00000227879
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGGTGCATGTTTCATAGGTCACG -3'
(R):5'- CAGTTGAGCCAGCTTCTGGTTGTC -3'

Sequencing Primer
(F):5'- ACCATATTGGTGTTACCAGGC -3'
(R):5'- AGCTTCTGGTTGTCATCATATTTAC -3'
Posted On2014-01-29