Incidental Mutation 'R1245:Zfp948'
ID152141
Institutional Source Beutler Lab
Gene Symbol Zfp948
Ensembl Gene ENSMUSG00000067931
Gene Namezinc finger protein 948
SynonymsBC049807
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21567046-21588697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21586842 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000086166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088787]
Predicted Effect probably damaging
Transcript: ENSMUST00000088787
AA Change: S99P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086166
Gene: ENSMUSG00000067931
AA Change: S99P

DomainStartEndE-ValueType
KRAB 13 72 1.04e-21 SMART
low complexity region 164 173 N/A INTRINSIC
ZnF_C2H2 214 236 3.16e-3 SMART
ZnF_C2H2 242 264 9.58e-3 SMART
ZnF_C2H2 270 292 2.84e-5 SMART
ZnF_C2H2 298 320 8.22e-2 SMART
ZnF_C2H2 353 375 1.69e-3 SMART
ZnF_C2H2 381 403 9.88e-5 SMART
ZnF_C2H2 409 431 9.08e-4 SMART
ZnF_C2H2 437 459 2.2e-2 SMART
ZnF_C2H2 465 487 5.99e-4 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 5.21e-4 SMART
ZnF_C2H2 549 571 9.73e-4 SMART
ZnF_C2H2 577 599 2.43e-4 SMART
ZnF_C2H2 605 627 2.91e-2 SMART
ZnF_C2H2 633 655 4.72e-2 SMART
Meta Mutation Damage Score 0.0392 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Zfp948
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Zfp948 APN 17 21587071 missense probably benign 0.01
R0212:Zfp948 UTSW 17 21588160 missense probably benign 0.01
R0225:Zfp948 UTSW 17 21587294 missense probably damaging 1.00
R0433:Zfp948 UTSW 17 21587502 missense probably benign 0.02
R0437:Zfp948 UTSW 17 21586998 missense unknown
R0490:Zfp948 UTSW 17 21588034 missense probably benign 0.02
R1818:Zfp948 UTSW 17 21584807 missense probably damaging 1.00
R2106:Zfp948 UTSW 17 21587691 nonsense probably null
R3692:Zfp948 UTSW 17 21587576 missense probably benign 0.01
R4767:Zfp948 UTSW 17 21588307 missense possibly damaging 0.61
R5226:Zfp948 UTSW 17 21588243 missense probably benign 0.00
R5753:Zfp948 UTSW 17 21586894 missense probably damaging 0.97
R5766:Zfp948 UTSW 17 21584816 missense probably benign 0.02
R5959:Zfp948 UTSW 17 21587514 missense probably benign 0.01
R6167:Zfp948 UTSW 17 21587649 missense probably benign 0.38
R6291:Zfp948 UTSW 17 21587024 missense unknown
R6312:Zfp948 UTSW 17 21587167 missense possibly damaging 0.56
R6482:Zfp948 UTSW 17 21587551 missense probably benign 0.01
X0023:Zfp948 UTSW 17 21586860 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTACCTGCCAGGAGCAAATGAG -3'
(R):5'- GCAATGCTGGAAGATTTGAGACTGTG -3'

Sequencing Primer
(F):5'- ATCTGGGAACAAGCCCTATTG -3'
(R):5'- GTGTGTAGAGCTGAAATGGC -3'
Posted On2014-01-29