Incidental Mutation 'R1247:4930527J03Rik'
List |< first << previous [record 81 of 1920] next >> last >|
ID152164
Institutional Source Beutler Lab
Gene Symbol 4930527J03Rik
Ensembl Gene ENSMUSG00000070489
Gene NameRIKEN cDNA 4930527J03 gene
Synonyms
MMRRC Submission 039314-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1247 (G1)
Quality Score196
Status Not validated
Chromosome1
Chromosomal Location178276047-178276641 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) ACCC to ACC at 178276503 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192920
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 C A 5: 150,541,274 A1501D probably damaging Het
Ctbp2 G C 7: 132,995,189 R722G probably benign Het
Cyp3a44 A G 5: 145,791,667 F249S probably damaging Het
Huwe1 G C X: 151,901,570 S2199T probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Samd4 AGG AG 14: 47,064,328 probably benign Het
Samd4 G GAAA 14: 47,087,758 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sox15 T C 11: 69,656,494 F190S probably benign Het
Syne2 G A 12: 75,967,490 A3153T probably benign Het
Tbr1 C T 2: 61,811,618 P409L possibly damaging Het
Other mutations in 4930527J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0294:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R0323:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R0392:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R1013:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R4804:4930527J03Rik UTSW 1 178276109 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCACCTGCTCAACAAAGCTGATTTC -3'
(R):5'- AGTGCTTCCTCCAGAACTAGGCTG -3'

Sequencing Primer
(F):5'- GAGAACTTGCCCTTCCTccg -3'
(R):5'- TCCAGAACTAGGCTGCTATTG -3'
Posted On2014-01-29