Incidental Mutation 'R1248:Atp2b2'
ID152187
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene NameATPase, Ca++ transporting, plasma membrane 2
SynonymsPMCA2, D6Abb2e, wms, jog, Gena300, Tmy
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113743831-114042613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113817192 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 118 (S118Y)
Ref Sequence ENSEMBL: ENSMUSP00000138165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
Predicted Effect probably damaging
Transcript: ENSMUST00000089003
AA Change: S118Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302
AA Change: S118Y

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101044
AA Change: S118Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302
AA Change: S118Y

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101045
AA Change: S118Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302
AA Change: S118Y

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135199
Predicted Effect probably damaging
Transcript: ENSMUST00000152831
AA Change: S118Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302
AA Change: S118Y

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205052
AA Change: S118Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302
AA Change: S118Y

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113805515 missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113789971 missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113813867 missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113793730 missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113813942 missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113793854 missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113748545 missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113759142 missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113760859 splice site probably benign
IGL03290:Atp2b2 APN 6 113793754 missense probably damaging 1.00
johan UTSW 6 113773388 missense probably damaging 1.00
lohan UTSW 6 113760650 missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113762852 nonsense probably null
R0116:Atp2b2 UTSW 6 113793695 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113793874 missense probably benign 0.07
R0421:Atp2b2 UTSW 6 113813888 missense probably damaging 1.00
R0791:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R1033:Atp2b2 UTSW 6 113793888 splice site probably null
R1524:Atp2b2 UTSW 6 113774201 splice site probably benign
R1809:Atp2b2 UTSW 6 113803743 intron probably benign
R1829:Atp2b2 UTSW 6 113773368 missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113842283 missense probably damaging 1.00
R2127:Atp2b2 UTSW 6 113760650 missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113796307 missense probably benign 0.21
R2351:Atp2b2 UTSW 6 113789757 missense possibly damaging 0.91
R3923:Atp2b2 UTSW 6 113797108 critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113760831 missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113793718 missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113765784 missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113760711 missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113789886 missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113842186 missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113759161 missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113759232 missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113759238 missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113842141 missense probably damaging 1.00
R5560:Atp2b2 UTSW 6 113774358 missense possibly damaging 0.90
R5589:Atp2b2 UTSW 6 113774439 missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113759309 missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113793767 missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113813877 missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113797131 missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113760720 missense probably damaging 1.00
R7231:Atp2b2 UTSW 6 113765732 missense possibly damaging 0.89
X0020:Atp2b2 UTSW 6 113805499 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805500 missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113842306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAAATGCCTCACCAATGCTCAC -3'
(R):5'- AGGCACTGCTCCAGACTTGGAAAAG -3'

Sequencing Primer
(F):5'- ATTACGACAGTTGGTCTAGCC -3'
(R):5'- CTCCAGACTTGGAAAAGAGGAAAC -3'
Posted On2014-01-29