Mutagenetix > Incidental Mutation

Incidental Mutation 'R1230:Ecm1'

152264

Institutional Source

Beutler Lab

Gene Symbol

Ecm1

Ensembl Gene

ENSMUSG00000028108

Gene Name

extracellular matrix protein 1

Synonyms

p85

MMRRC Submission

039299-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R1230 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95641459-95646880 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 95642738 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000199464] [ENSMUST00000163530] [ENSMUST00000196077] [ENSMUST00000147217] [ENSMUST00000153026]

AlphaFold

Q61508

Predicted Effect

probably benign
Transcript: ENSMUST00000029752

SMART Domains

Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	5.6e-14	PFAM
tRNA_SAD	233	282	1.15e-10	SMART
Pfam:tRNA-synt_2b	400	608	2.4e-32	PFAM
Pfam:HGTP_anticodon	620	711	1.5e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000029753

SMART Domains

Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	558	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074339

SMART Domains

Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	1.3e-15	PFAM
tRNA_SAD	233	282	1.15e-10	SMART
Pfam:tRNA-synt_2b	336	519	2.8e-39	PFAM
Pfam:HGTP_anticodon	594	685	5.4e-20	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000117507

SMART Domains

Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	559	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123143

SMART Domains

Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	266	4.4e-132	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128885

SMART Domains

Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	251	1.5e-135	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131376

SMART Domains

Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	295	4.2e-146	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155815

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183853

Predicted Effect

probably benign
Transcript: ENSMUST00000137912

SMART Domains

Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	140	1.8e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199464

SMART Domains

Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	1.1e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163530

SMART Domains

Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	66	126	2.6e-15	PFAM
tRNA_SAD	152	201	1.15e-10	SMART
Pfam:tRNA-synt_2b	255	438	8.6e-40	PFAM
Pfam:HGTP_anticodon	539	630	1.6e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196077

SMART Domains

Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

Domain	Start	End	E-Value	Type
Pfam:TGS	65	125	5e-13	PFAM
tRNA_SAD	232	264	7.5e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147217

SMART Domains

Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	80	5.2e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153026

SMART Domains

Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108

Domain	Start	End	E-Value	Type
Pfam:ECM1	1	230	1.3e-100	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit auto-inflammatory disease and do not survive beyond 6 to 8 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc88c	A	T	12: 100,914,747 (GRCm39)	Y496N	probably benign	Het
Cyp11b1	A	G	15: 74,712,791 (GRCm39)	I90T	probably benign	Het
Cyp4f14	C	A	17: 33,135,762 (GRCm39)	R33L	probably benign	Het
Dcc	G	A	18: 71,815,384 (GRCm39)	P330L	probably damaging	Het
Dnm1	T	C	2: 32,205,921 (GRCm39)	N64D	probably damaging	Het
Dync1h1	G	A	12: 110,602,943 (GRCm39)	E2195K	probably benign	Het
Enam	A	G	5: 88,641,927 (GRCm39)	Y247C	probably damaging	Het
Ess2	C	T	16: 17,727,814 (GRCm39)	V122M	probably benign	Het
Gtf3c3	C	T	1: 54,456,937 (GRCm39)	A488T	probably damaging	Het
Hrc	A	G	7: 44,985,887 (GRCm39)	D346G	possibly damaging	Het
Kdm5b	T	G	1: 134,540,992 (GRCm39)	C695G	probably damaging	Het
Lrig3	A	G	10: 125,838,840 (GRCm39)	D449G	probably damaging	Het
Mrps31	C	T	8: 22,909,759 (GRCm39)	P142S	possibly damaging	Het
Ppm1k	T	C	6: 57,502,059 (GRCm39)	T35A	probably benign	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
Vangl1	T	A	3: 102,065,609 (GRCm39)	I509L	probably benign	Het
Vcpip1	A	G	1: 9,795,449 (GRCm39)	V974A	probably damaging	Het
Xdh	T	C	17: 74,198,251 (GRCm39)	E1212G	probably damaging	Het
Zfp62	T	C	11: 49,105,926 (GRCm39)	S6P	probably damaging	Het

Other mutations in Ecm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Ecm1	APN	3	95,642,211 (GRCm39)	missense	probably damaging	1.00
IGL01686:Ecm1	APN	3	95,643,376 (GRCm39)	missense	probably benign
IGL01807:Ecm1	APN	3	95,643,891 (GRCm39)	missense	probably damaging	1.00
IGL01862:Ecm1	APN	3	95,641,586 (GRCm39)	missense	probably benign	0.08
IGL02006:Ecm1	APN	3	95,641,557 (GRCm39)	missense	probably damaging	0.98
IGL02134:Ecm1	APN	3	95,643,499 (GRCm39)	missense	probably damaging	1.00
IGL02210:Ecm1	APN	3	95,643,289 (GRCm39)	missense	probably damaging	0.97
IGL02813:Ecm1	APN	3	95,644,098 (GRCm39)	missense	probably damaging	0.99
IGL02959:Ecm1	APN	3	95,644,989 (GRCm39)	missense	probably damaging	1.00
R0362:Ecm1	UTSW	3	95,644,369 (GRCm39)	missense	possibly damaging	0.93
R0963:Ecm1	UTSW	3	95,643,900 (GRCm39)	missense	possibly damaging	0.95
R1181:Ecm1	UTSW	3	95,642,662 (GRCm39)	missense	possibly damaging	0.85
R1483:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R1484:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R1559:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R1561:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R1562:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R1590:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R1591:Ecm1	UTSW	3	95,643,275 (GRCm39)	missense	probably damaging	1.00
R2110:Ecm1	UTSW	3	95,643,254 (GRCm39)	missense	probably benign	0.14
R3236:Ecm1	UTSW	3	95,642,158 (GRCm39)	missense	possibly damaging	0.71
R3897:Ecm1	UTSW	3	95,643,298 (GRCm39)	missense	probably damaging	0.99
R4084:Ecm1	UTSW	3	95,641,676 (GRCm39)	missense	probably damaging	0.98
R4770:Ecm1	UTSW	3	95,645,273 (GRCm39)	unclassified	probably benign
R4985:Ecm1	UTSW	3	95,643,415 (GRCm39)	missense	possibly damaging	0.55
R5506:Ecm1	UTSW	3	95,643,169 (GRCm39)	missense	probably benign	0.00
R5861:Ecm1	UTSW	3	95,643,909 (GRCm39)	missense	probably damaging	1.00
R7472:Ecm1	UTSW	3	95,642,632 (GRCm39)	missense	possibly damaging	0.93
R7678:Ecm1	UTSW	3	95,643,494 (GRCm39)	missense	probably damaging	0.97
R7704:Ecm1	UTSW	3	95,643,843 (GRCm39)	missense	probably damaging	0.99
R7864:Ecm1	UTSW	3	95,641,689 (GRCm39)	missense	probably benign	0.09
Z1088:Ecm1	UTSW	3	95,642,188 (GRCm39)	missense	probably benign
Z1176:Ecm1	UTSW	3	95,642,188 (GRCm39)	missense	probably benign
Z1177:Ecm1	UTSW	3	95,642,188 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGGTCAAGGGTCAAGATATCCCG -3'
(R):5'- GTCCGTTGTGTCTGTCATCCAAGTC -3'

Sequencing Primer
(F):5'- GTCAAGATATCCCGGTCATAGTTG -3'
(R):5'- tgtgtctgtcATCCAAGTCTGTTC -3'

Posted On

2014-01-29