Incidental Mutation 'R1230:Ecm1'
ID152264
Institutional Source Beutler Lab
Gene Symbol Ecm1
Ensembl Gene ENSMUSG00000028108
Gene Nameextracellular matrix protein 1
Synonymsp85
MMRRC Submission 039299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R1230 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95734147-95739569 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 95735426 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000147217] [ENSMUST00000153026] [ENSMUST00000163530] [ENSMUST00000196077] [ENSMUST00000199464]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029753
SMART Domains Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 558 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117507
SMART Domains Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 559 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123143
SMART Domains Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 266 4.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128885
SMART Domains Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 251 1.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131376
SMART Domains Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 295 4.2e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137912
SMART Domains Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 140 1.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144958
Predicted Effect probably benign
Transcript: ENSMUST00000147217
SMART Domains Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 80 5.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153026
SMART Domains Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 230 1.3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155815
Predicted Effect probably benign
Transcript: ENSMUST00000163530
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183853
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200376
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit auto-inflammatory disease and do not survive beyond 6 to 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88c A T 12: 100,948,488 Y496N probably benign Het
Cyp11b1 A G 15: 74,840,942 I90T probably benign Het
Cyp4f14 C A 17: 32,916,788 R33L probably benign Het
Dcc G A 18: 71,682,313 P330L probably damaging Het
Dgcr14 C T 16: 17,909,950 V122M probably benign Het
Dnm1 T C 2: 32,315,909 N64D probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Enam A G 5: 88,494,068 Y247C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hrc A G 7: 45,336,463 D346G possibly damaging Het
Kdm5b T G 1: 134,613,254 C695G probably damaging Het
Lrig3 A G 10: 126,002,971 D449G probably damaging Het
Mrps31 C T 8: 22,419,743 P142S possibly damaging Het
Ppm1k T C 6: 57,525,074 T35A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Vangl1 T A 3: 102,158,293 I509L probably benign Het
Vcpip1 A G 1: 9,725,224 V974A probably damaging Het
Xdh T C 17: 73,891,256 E1212G probably damaging Het
Zfp62 T C 11: 49,215,099 S6P probably damaging Het
Other mutations in Ecm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ecm1 APN 3 95734899 missense probably damaging 1.00
IGL01686:Ecm1 APN 3 95736064 missense probably benign
IGL01807:Ecm1 APN 3 95736579 missense probably damaging 1.00
IGL01862:Ecm1 APN 3 95734273 missense probably benign 0.08
IGL02006:Ecm1 APN 3 95734244 missense probably damaging 0.98
IGL02134:Ecm1 APN 3 95736187 missense probably damaging 1.00
IGL02210:Ecm1 APN 3 95735977 missense probably damaging 0.97
IGL02813:Ecm1 APN 3 95736786 missense probably damaging 0.99
IGL02959:Ecm1 APN 3 95737677 missense probably damaging 1.00
R0362:Ecm1 UTSW 3 95737057 missense possibly damaging 0.93
R0963:Ecm1 UTSW 3 95736588 missense possibly damaging 0.95
R1181:Ecm1 UTSW 3 95735350 missense possibly damaging 0.85
R1483:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1484:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1559:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1561:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1562:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1590:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1591:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R2110:Ecm1 UTSW 3 95735942 missense probably benign 0.14
R3236:Ecm1 UTSW 3 95734846 missense possibly damaging 0.71
R3897:Ecm1 UTSW 3 95735986 missense probably damaging 0.99
R4084:Ecm1 UTSW 3 95734363 missense probably damaging 0.98
R4770:Ecm1 UTSW 3 95737961 unclassified probably benign
R4985:Ecm1 UTSW 3 95736103 missense possibly damaging 0.55
R5506:Ecm1 UTSW 3 95735857 missense probably benign 0.00
R5861:Ecm1 UTSW 3 95736597 missense probably damaging 1.00
Z1088:Ecm1 UTSW 3 95734876 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGTCAAGGGTCAAGATATCCCG -3'
(R):5'- GTCCGTTGTGTCTGTCATCCAAGTC -3'

Sequencing Primer
(F):5'- GTCAAGATATCCCGGTCATAGTTG -3'
(R):5'- tgtgtctgtcATCCAAGTCTGTTC -3'
Posted On2014-01-29