Mutagenetix > Incidental Mutation

Incidental Mutation 'R1230:Enam'

152266

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

039299-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.337) question?

Stock #

R1230 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88635834-88653908 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88641927 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 247 (Y247C)

Ref Sequence

ENSEMBL: ENSMUSP00000142854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

AlphaFold

O55196

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031222
AA Change: Y172C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: Y172C

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199104
AA Change: Y247C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: Y247C

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc88c	A	T	12: 100,914,747 (GRCm39)	Y496N	probably benign	Het
Cyp11b1	A	G	15: 74,712,791 (GRCm39)	I90T	probably benign	Het
Cyp4f14	C	A	17: 33,135,762 (GRCm39)	R33L	probably benign	Het
Dcc	G	A	18: 71,815,384 (GRCm39)	P330L	probably damaging	Het
Dnm1	T	C	2: 32,205,921 (GRCm39)	N64D	probably damaging	Het
Dync1h1	G	A	12: 110,602,943 (GRCm39)	E2195K	probably benign	Het
Ecm1	A	T	3: 95,642,738 (GRCm39)		probably null	Het
Ess2	C	T	16: 17,727,814 (GRCm39)	V122M	probably benign	Het
Gtf3c3	C	T	1: 54,456,937 (GRCm39)	A488T	probably damaging	Het
Hrc	A	G	7: 44,985,887 (GRCm39)	D346G	possibly damaging	Het
Kdm5b	T	G	1: 134,540,992 (GRCm39)	C695G	probably damaging	Het
Lrig3	A	G	10: 125,838,840 (GRCm39)	D449G	probably damaging	Het
Mrps31	C	T	8: 22,909,759 (GRCm39)	P142S	possibly damaging	Het
Ppm1k	T	C	6: 57,502,059 (GRCm39)	T35A	probably benign	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
Vangl1	T	A	3: 102,065,609 (GRCm39)	I509L	probably benign	Het
Vcpip1	A	G	1: 9,795,449 (GRCm39)	V974A	probably damaging	Het
Xdh	T	C	17: 74,198,251 (GRCm39)	E1212G	probably damaging	Het
Zfp62	T	C	11: 49,105,926 (GRCm39)	S6P	probably damaging	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88,649,343 (GRCm39)	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88,651,608 (GRCm39)	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88,651,533 (GRCm39)	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88,652,418 (GRCm39)	nonsense	probably null
IGL02371:Enam	APN	5	88,650,668 (GRCm39)	missense	probably benign	0.39
IGL02596:Enam	APN	5	88,650,885 (GRCm39)	missense	probably benign	0.01
IGL03026:Enam	APN	5	88,651,158 (GRCm39)	missense	probably benign	0.38
IGL03303:Enam	APN	5	88,652,450 (GRCm39)	missense	probably benign	0.12
opinionated	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
recalcitrant	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R0200:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0230:Enam	UTSW	5	88,637,514 (GRCm39)	splice site	probably benign
R0395:Enam	UTSW	5	88,649,367 (GRCm39)	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88,650,964 (GRCm39)	missense	probably damaging	0.96
R0608:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0724:Enam	UTSW	5	88,649,853 (GRCm39)	missense	probably damaging	1.00
R0927:Enam	UTSW	5	88,641,919 (GRCm39)	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88,649,826 (GRCm39)	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88,651,878 (GRCm39)	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88,651,117 (GRCm39)	missense	probably damaging	1.00
R1324:Enam	UTSW	5	88,641,927 (GRCm39)	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88,651,086 (GRCm39)	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88,652,324 (GRCm39)	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88,652,481 (GRCm39)	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88,649,646 (GRCm39)	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88,640,779 (GRCm39)	missense	probably benign	0.02
R2196:Enam	UTSW	5	88,650,603 (GRCm39)	missense	probably damaging	0.99
R2363:Enam	UTSW	5	88,651,008 (GRCm39)	missense	probably benign	0.24
R2497:Enam	UTSW	5	88,650,553 (GRCm39)	missense	probably benign	0.13
R3615:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88,650,674 (GRCm39)	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88,651,236 (GRCm39)	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88,651,407 (GRCm39)	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88,652,142 (GRCm39)	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88,640,827 (GRCm39)	missense	probably benign	0.02
R4702:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4703:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4704:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4705:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4714:Enam	UTSW	5	88,651,395 (GRCm39)	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88,649,402 (GRCm39)	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88,640,967 (GRCm39)	nonsense	probably null
R4840:Enam	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
R4856:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4886:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4910:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R4911:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R6103:Enam	UTSW	5	88,650,187 (GRCm39)	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88,650,776 (GRCm39)	missense	probably damaging	0.98
R6759:Enam	UTSW	5	88,649,550 (GRCm39)	missense	probably damaging	1.00
R7282:Enam	UTSW	5	88,650,186 (GRCm39)	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88,649,347 (GRCm39)	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88,649,523 (GRCm39)	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88,649,679 (GRCm39)	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88,650,884 (GRCm39)	missense	probably benign	0.00
R7648:Enam	UTSW	5	88,652,016 (GRCm39)	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88,651,830 (GRCm39)	missense	possibly damaging	0.80
R7943:Enam	UTSW	5	88,636,410 (GRCm39)	splice site	probably null
R7999:Enam	UTSW	5	88,651,561 (GRCm39)	missense	probably benign
R8117:Enam	UTSW	5	88,651,385 (GRCm39)	missense	probably benign	0.00
R8419:Enam	UTSW	5	88,651,209 (GRCm39)	missense	possibly damaging	0.80
R8528:Enam	UTSW	5	88,650,078 (GRCm39)	missense	probably damaging	0.98
R8836:Enam	UTSW	5	88,639,124 (GRCm39)	critical splice donor site	probably null
R8973:Enam	UTSW	5	88,641,947 (GRCm39)	missense	possibly damaging	0.96
R9001:Enam	UTSW	5	88,637,388 (GRCm39)	missense	probably benign	0.11
R9033:Enam	UTSW	5	88,646,475 (GRCm39)	missense	probably benign	0.01
R9268:Enam	UTSW	5	88,640,778 (GRCm39)	missense	probably benign	0.01
R9723:Enam	UTSW	5	88,652,241 (GRCm39)	missense	probably damaging	1.00
X0018:Enam	UTSW	5	88,650,550 (GRCm39)	nonsense	probably null
Z1176:Enam	UTSW	5	88,640,830 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAAGGTTGAAATCTGAAAGAGTCCC -3'
(R):5'- TCTGTTCATGTTGCAAACTGGTCTGAG -3'

Sequencing Primer
(F):5'- gaaggagggaggggagaag -3'
(R):5'- GTTGCAAACTGGTCTGAGTAAAAC -3'

Posted On

2014-01-29