Incidental Mutation 'R1230:Ppm1k'
ID152267
Institutional Source Beutler Lab
Gene Symbol Ppm1k
Ensembl Gene ENSMUSG00000037826
Gene Nameprotein phosphatase 1K (PP2C domain containing)
SynonymsA930026L03Rik, 2900063A19Rik, PP2Cm
MMRRC Submission 039299-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R1230 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57506502-57535468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57525074 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 35 (T35A)
Ref Sequence ENSEMBL: ENSMUSP00000041395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042766]
Predicted Effect probably benign
Transcript: ENSMUST00000042766
AA Change: T35A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041395
Gene: ENSMUSG00000037826
AA Change: T35A

DomainStartEndE-ValueType
PP2Cc 88 344 2.16e-68 SMART
PP2C_SIG 93 346 1.15e-3 SMART
low complexity region 359 368 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204686
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit defective amino acid metabolism, increased oxidative stress, and increased mortality when subjected to a high-protein diet while in utero and during postnatal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88c A T 12: 100,948,488 Y496N probably benign Het
Cyp11b1 A G 15: 74,840,942 I90T probably benign Het
Cyp4f14 C A 17: 32,916,788 R33L probably benign Het
Dcc G A 18: 71,682,313 P330L probably damaging Het
Dgcr14 C T 16: 17,909,950 V122M probably benign Het
Dnm1 T C 2: 32,315,909 N64D probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ecm1 A T 3: 95,735,426 probably null Het
Enam A G 5: 88,494,068 Y247C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hrc A G 7: 45,336,463 D346G possibly damaging Het
Kdm5b T G 1: 134,613,254 C695G probably damaging Het
Lrig3 A G 10: 126,002,971 D449G probably damaging Het
Mrps31 C T 8: 22,419,743 P142S possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Vangl1 T A 3: 102,158,293 I509L probably benign Het
Vcpip1 A G 1: 9,725,224 V974A probably damaging Het
Xdh T C 17: 73,891,256 E1212G probably damaging Het
Zfp62 T C 11: 49,215,099 S6P probably damaging Het
Other mutations in Ppm1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ppm1k APN 6 57524755 missense probably benign 0.05
IGL01395:Ppm1k APN 6 57513958 missense probably benign
IGL01923:Ppm1k APN 6 57522828 missense probably benign 0.01
IGL02484:Ppm1k APN 6 57525012 missense possibly damaging 0.59
IGL03149:Ppm1k APN 6 57524774 missense probably damaging 0.99
IGL03340:Ppm1k APN 6 57510726 missense probably damaging 1.00
R1425:Ppm1k UTSW 6 57524789 missense probably damaging 1.00
R1522:Ppm1k UTSW 6 57525157 missense possibly damaging 0.48
R3508:Ppm1k UTSW 6 57514990 missense probably damaging 0.99
R3751:Ppm1k UTSW 6 57524860 missense probably benign 0.01
R4845:Ppm1k UTSW 6 57522768 nonsense probably null
R4914:Ppm1k UTSW 6 57510777 missense probably damaging 0.99
R4915:Ppm1k UTSW 6 57510777 missense probably damaging 0.99
R4918:Ppm1k UTSW 6 57510777 missense probably damaging 0.99
R5430:Ppm1k UTSW 6 57524886 nonsense probably null
R6907:Ppm1k UTSW 6 57510770 missense probably benign 0.01
R6962:Ppm1k UTSW 6 57515660 missense probably damaging 0.99
X0024:Ppm1k UTSW 6 57514010 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCACGTTCTCCAGGCTAATTTTG -3'
(R):5'- TGCACACATGCACTGTCAGACTC -3'

Sequencing Primer
(F):5'- CTAATTTTGGGAATTGGTTTGCC -3'
(R):5'- cacatgcacTGTCAGACTCTTTATG -3'
Posted On2014-01-29