Incidental Mutation 'R1230:Cyp11b1'
ID152276
Institutional Source Beutler Lab
Gene Symbol Cyp11b1
Ensembl Gene ENSMUSG00000075604
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 1
SynonymsCyp11b-1, Cyp11b
MMRRC Submission 039299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1230 (G1)
Quality Score136
Status Not validated
Chromosome15
Chromosomal Location74834125-74841643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74840942 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 90 (I90T)
Ref Sequence ENSEMBL: ENSMUSP00000127888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170259]
Predicted Effect probably benign
Transcript: ENSMUST00000170259
AA Change: I90T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127888
Gene: ENSMUSG00000075604
AA Change: I90T

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 497 4.3e-109 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit adrenal hypertrophy, abnormal organ weights, abnormal hormone levels, abnormal urine chemistry, hypokalemia, increased blood pressure, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88c A T 12: 100,948,488 Y496N probably benign Het
Cyp4f14 C A 17: 32,916,788 R33L probably benign Het
Dcc G A 18: 71,682,313 P330L probably damaging Het
Dgcr14 C T 16: 17,909,950 V122M probably benign Het
Dnm1 T C 2: 32,315,909 N64D probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ecm1 A T 3: 95,735,426 probably null Het
Enam A G 5: 88,494,068 Y247C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hrc A G 7: 45,336,463 D346G possibly damaging Het
Kdm5b T G 1: 134,613,254 C695G probably damaging Het
Lrig3 A G 10: 126,002,971 D449G probably damaging Het
Mrps31 C T 8: 22,419,743 P142S possibly damaging Het
Ppm1k T C 6: 57,525,074 T35A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Vangl1 T A 3: 102,158,293 I509L probably benign Het
Vcpip1 A G 1: 9,725,224 V974A probably damaging Het
Xdh T C 17: 73,891,256 E1212G probably damaging Het
Zfp62 T C 11: 49,215,099 S6P probably damaging Het
Other mutations in Cyp11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Cyp11b1 APN 15 74835853 unclassified probably null
IGL01154:Cyp11b1 APN 15 74838534 missense probably benign
IGL01982:Cyp11b1 APN 15 74839403 missense possibly damaging 0.69
IGL02156:Cyp11b1 APN 15 74835797 missense probably benign 0.25
IGL02424:Cyp11b1 APN 15 74839236 missense probably benign 0.23
IGL02937:Cyp11b1 APN 15 74836559 missense possibly damaging 0.81
IGL03080:Cyp11b1 APN 15 74839436 splice site probably null
IGL03101:Cyp11b1 APN 15 74835854 missense probably benign 0.39
R1699:Cyp11b1 UTSW 15 74840817 missense possibly damaging 0.89
R1755:Cyp11b1 UTSW 15 74838534 missense probably benign
R2913:Cyp11b1 UTSW 15 74836421 missense probably damaging 0.99
R4361:Cyp11b1 UTSW 15 74839016 missense possibly damaging 0.87
R4459:Cyp11b1 UTSW 15 74836359 missense probably damaging 0.98
R5822:Cyp11b1 UTSW 15 74836821 missense probably null 1.00
R6921:Cyp11b1 UTSW 15 74840949 missense probably benign 0.00
X0064:Cyp11b1 UTSW 15 74841587 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCCCCAGGATGGTCTACCTCAAATC -3'
(R):5'- TGTTCAGAGAAAGGCACTGCTCAC -3'

Sequencing Primer
(F):5'- CAGCATTGCTAGACATTGGGC -3'
(R):5'- CTGCTCACTGCTGAGAGGATAG -3'
Posted On2014-01-29