Incidental Mutation 'R1230:Dgcr14'
ID152277
Institutional Source Beutler Lab
Gene Symbol Dgcr14
Ensembl Gene ENSMUSG00000003527
Gene NameDiGeorge syndrome critical region gene 14
SynonymsDgsi, ES2, Es2el, D16H22S1269E
MMRRC Submission 039299-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R1230 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17900709-17911348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17909950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 122 (V122M)
Ref Sequence ENSEMBL: ENSMUSP00000003621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000012279] [ENSMUST00000232423] [ENSMUST00000232493]
Predicted Effect probably benign
Transcript: ENSMUST00000003621
AA Change: V122M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527
AA Change: V122M

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012279
SMART Domains Protein: ENSMUSP00000012279
Gene: ENSMUSG00000022738

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
HOX 136 198 2.9e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232366
Predicted Effect probably benign
Transcript: ENSMUST00000232423
AA Change: V122M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232493
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: The human ortholog of this gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome, and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of human chromosome band 22q11.2. The encoded protein localizes to the nucleus, and the orthologous protein in humans co-purifies with C complex spliceosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88c A T 12: 100,948,488 Y496N probably benign Het
Cyp11b1 A G 15: 74,840,942 I90T probably benign Het
Cyp4f14 C A 17: 32,916,788 R33L probably benign Het
Dcc G A 18: 71,682,313 P330L probably damaging Het
Dnm1 T C 2: 32,315,909 N64D probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ecm1 A T 3: 95,735,426 probably null Het
Enam A G 5: 88,494,068 Y247C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hrc A G 7: 45,336,463 D346G possibly damaging Het
Kdm5b T G 1: 134,613,254 C695G probably damaging Het
Lrig3 A G 10: 126,002,971 D449G probably damaging Het
Mrps31 C T 8: 22,419,743 P142S possibly damaging Het
Ppm1k T C 6: 57,525,074 T35A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Vangl1 T A 3: 102,158,293 I509L probably benign Het
Vcpip1 A G 1: 9,725,224 V974A probably damaging Het
Xdh T C 17: 73,891,256 E1212G probably damaging Het
Zfp62 T C 11: 49,215,099 S6P probably damaging Het
Other mutations in Dgcr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Dgcr14 APN 16 17902932 missense probably damaging 1.00
IGL02279:Dgcr14 APN 16 17902911 missense possibly damaging 0.95
R0227:Dgcr14 UTSW 16 17902271 missense probably damaging 0.97
R0316:Dgcr14 UTSW 16 17910094 missense probably benign 0.06
R0669:Dgcr14 UTSW 16 17907555 missense probably damaging 1.00
R0880:Dgcr14 UTSW 16 17911187 missense probably damaging 0.96
R1429:Dgcr14 UTSW 16 17902205 nonsense probably null
R1633:Dgcr14 UTSW 16 17909967 missense probably benign 0.03
R1891:Dgcr14 UTSW 16 17907780 nonsense probably null
R2035:Dgcr14 UTSW 16 17910086 critical splice donor site probably null
R2267:Dgcr14 UTSW 16 17909995 missense probably damaging 1.00
R7126:Dgcr14 UTSW 16 17911290 missense not run
Predicted Primers PCR Primer
(F):5'- CTGGAACACTGAACACAGACTGGG -3'
(R):5'- CATGCGCCAGATTGCCATCAAG -3'

Sequencing Primer
(F):5'- acgcctttaatcccagcac -3'
(R):5'- AAGTTTGGCTCTGCCCTG -3'
Posted On2014-01-29