Mutagenetix > Incidental Mutation

Incidental Mutation 'R1231:Gtf3c3'

152283

Institutional Source

Beutler Lab

Gene Symbol

Gtf3c3

Ensembl Gene

ENSMUSG00000041303

Gene Name

general transcription factor IIIC, polypeptide 3

Synonyms

MMRRC Submission

039300-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R1231 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54435163-54478130 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54456937 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 488 (A488T)

Ref Sequence

ENSEMBL: ENSMUSP00000039420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041638]

AlphaFold

Q3TMP1

Predicted Effect

probably damaging
Transcript: ENSMUST00000041638
AA Change: A488T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A488T

Domain	Start	End	E-Value	Type
low complexity region	18	34	N/A	INTRINSIC
low complexity region	92	108	N/A	INTRINSIC
TPR	145	178	9.24e1	SMART
TPR	179	212	2.36e1	SMART
TPR	213	246	4.58e-4	SMART
TPR	247	280	6.4e1	SMART
Blast:TPR	286	319	6e-9	BLAST
low complexity region	353	365	N/A	INTRINSIC
TPR	452	485	1.87e1	SMART
low complexity region	549	560	N/A	INTRINSIC
TPR	807	840	3.27e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190419

Meta Mutation Damage Score

0.6542

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	C	T	10: 50,699,756 (GRCm39)	P1860S	probably damaging	Het
Cabp5	T	C	7: 13,139,350 (GRCm39)	I125T	probably damaging	Het
Ccnd2	A	T	6: 127,107,363 (GRCm39)	S269T	probably benign	Het
Cmss1	C	T	16: 57,136,560 (GRCm39)	R104H	probably benign	Het
Dock9	A	T	14: 121,813,362 (GRCm39)	M1522K	possibly damaging	Het
Fcrl5	A	G	3: 87,349,486 (GRCm39)	H87R	probably benign	Het
Gabrr3	G	A	16: 59,281,763 (GRCm39)	D373N	probably benign	Het
Gm21738	T	A	14: 19,415,957 (GRCm38)	Y194F	probably benign	Het
Gm21738	T	C	14: 19,415,963 (GRCm38)	K192R	probably benign	Het
Itgae	C	T	11: 73,010,205 (GRCm39)	T565I	probably benign	Het
Mocos	G	T	18: 24,812,758 (GRCm39)	A551S	probably benign	Het
Mtmr9	A	T	14: 63,765,640 (GRCm39)	N418K	possibly damaging	Het
Mtus2	T	A	5: 148,014,198 (GRCm39)	S330R	probably benign	Het
Or2t1	A	T	14: 14,328,515 (GRCm38)	M135L	probably benign	Het
Psg16	T	A	7: 16,829,230 (GRCm39)	Y271*	probably null	Het
Psmd2	T	A	16: 20,474,335 (GRCm39)	M297K	possibly damaging	Het
Rnf220	A	T	4: 117,347,081 (GRCm39)	S110R	probably damaging	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
St8sia5	T	C	18: 77,320,502 (GRCm39)	Y49H	probably damaging	Het
Umodl1	A	G	17: 31,178,252 (GRCm39)	Y76C	probably damaging	Het
Urm1	G	T	2: 29,722,711 (GRCm39)	A15S	probably damaging	Het

Other mutations in Gtf3c3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Gtf3c3	APN	1	54,455,114 (GRCm39)	missense	probably damaging	0.99
IGL00435:Gtf3c3	APN	1	54,466,694 (GRCm39)	missense	possibly damaging	0.73
IGL01128:Gtf3c3	APN	1	54,468,035 (GRCm39)	missense	possibly damaging	0.91
R0243:Gtf3c3	UTSW	1	54,442,695 (GRCm39)	missense	possibly damaging	0.60
R0271:Gtf3c3	UTSW	1	54,467,971 (GRCm39)	missense	possibly damaging	0.96
R0571:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R0965:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R0968:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1069:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1070:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1111:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1112:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1113:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1114:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1115:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1117:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1118:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1119:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1228:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1230:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1382:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1394:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1395:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1397:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1414:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1430:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1432:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1473:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1497:Gtf3c3	UTSW	1	54,477,098 (GRCm39)	missense	probably benign
R1556:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1563:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1638:Gtf3c3	UTSW	1	54,444,278 (GRCm39)	missense	probably damaging	1.00
R1695:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1716:Gtf3c3	UTSW	1	54,438,419 (GRCm39)	missense	probably damaging	1.00
R1745:Gtf3c3	UTSW	1	54,473,371 (GRCm39)	missense	probably damaging	1.00
R1767:Gtf3c3	UTSW	1	54,456,937 (GRCm39)	missense	probably damaging	1.00
R1799:Gtf3c3	UTSW	1	54,459,583 (GRCm39)	missense	possibly damaging	0.82
R1861:Gtf3c3	UTSW	1	54,477,997 (GRCm39)	missense	possibly damaging	0.87
R1940:Gtf3c3	UTSW	1	54,468,117 (GRCm39)	splice site	probably benign
R3804:Gtf3c3	UTSW	1	54,463,166 (GRCm39)	critical splice donor site	probably null
R4496:Gtf3c3	UTSW	1	54,463,291 (GRCm39)	missense	probably benign	0.03
R4621:Gtf3c3	UTSW	1	54,458,575 (GRCm39)	missense	probably damaging	1.00
R5131:Gtf3c3	UTSW	1	54,458,657 (GRCm39)	splice site	probably null
R5320:Gtf3c3	UTSW	1	54,445,032 (GRCm39)	missense	probably damaging	1.00
R5605:Gtf3c3	UTSW	1	54,455,085 (GRCm39)	missense	probably benign	0.06
R5854:Gtf3c3	UTSW	1	54,458,596 (GRCm39)	missense	probably benign	0.01
R6050:Gtf3c3	UTSW	1	54,445,229 (GRCm39)	missense	probably benign	0.00
R6441:Gtf3c3	UTSW	1	54,445,197 (GRCm39)	missense	probably benign	0.03
R6892:Gtf3c3	UTSW	1	54,455,100 (GRCm39)	missense	probably benign	0.00
R7114:Gtf3c3	UTSW	1	54,462,666 (GRCm39)	missense	probably benign
R7299:Gtf3c3	UTSW	1	54,456,867 (GRCm39)	missense	probably benign	0.01
R7441:Gtf3c3	UTSW	1	54,459,607 (GRCm39)	missense	probably benign	0.00
R7586:Gtf3c3	UTSW	1	54,442,752 (GRCm39)	missense	probably damaging	1.00
R7615:Gtf3c3	UTSW	1	54,462,731 (GRCm39)	missense	possibly damaging	0.49
R7634:Gtf3c3	UTSW	1	54,458,800 (GRCm39)	splice site	probably null
R7739:Gtf3c3	UTSW	1	54,444,198 (GRCm39)	missense	possibly damaging	0.94
R8349:Gtf3c3	UTSW	1	54,468,068 (GRCm39)	missense	probably damaging	1.00
R8449:Gtf3c3	UTSW	1	54,468,068 (GRCm39)	missense	probably damaging	1.00
R8755:Gtf3c3	UTSW	1	54,468,031 (GRCm39)	missense	probably benign
R8955:Gtf3c3	UTSW	1	54,462,722 (GRCm39)	missense	probably benign	0.00
R9290:Gtf3c3	UTSW	1	54,477,997 (GRCm39)	missense	possibly damaging	0.87
R9353:Gtf3c3	UTSW	1	54,445,211 (GRCm39)	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TGATCTGCCATGCAAGCCTAAAGAC -3'
(R):5'- AGGATTGCAAATCAGTGAGGCTGTG -3'

Sequencing Primer
(F):5'- gaaggaccctgatgctcac -3'
(R):5'- TCAGTGAGGCTGTGTCATAAAG -3'

Posted On

2014-01-29