Incidental Mutation 'R1231:Fcrl5'
ID152286
Institutional Source Beutler Lab
Gene Symbol Fcrl5
Ensembl Gene ENSMUSG00000048031
Gene NameFc receptor-like 5
SynonymsBXMAS1-like protein 2, Fcrh3, mBXMH2
MMRRC Submission 039300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R1231 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87435773-87500678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87442179 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 87 (H87R)
Ref Sequence ENSEMBL: ENSMUSP00000136046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049926] [ENSMUST00000166297] [ENSMUST00000178261] [ENSMUST00000193229] [ENSMUST00000194102]
Predicted Effect probably benign
Transcript: ENSMUST00000049926
AA Change: H87R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000050151
Gene: ENSMUSG00000048031
AA Change: H87R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166297
SMART Domains Protein: ENSMUSP00000131176
Gene: ENSMUSG00000048031

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178261
AA Change: H87R

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136046
Gene: ENSMUSG00000048031
AA Change: H87R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193229
SMART Domains Protein: ENSMUSP00000141311
Gene: ENSMUSG00000048031

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194102
AA Change: H87R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142210
Gene: ENSMUSG00000048031
AA Change: H87R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and the Fc-receptor like family. This gene and several other Fc receptor-like gene members are clustered on the long arm of chromosome 1. The encoded protein is a single-pass type I membrane protein and contains 8 immunoglobulin-like C2-type domains. This gene is implicated in B cell development and lymphomagenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 C T 10: 50,823,660 P1860S probably damaging Het
Cabp5 T C 7: 13,405,425 I125T probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Dock9 A T 14: 121,575,950 M1522K possibly damaging Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Itgae C T 11: 73,119,379 T565I probably benign Het
Mocos G T 18: 24,679,701 A551S probably benign Het
Mtmr9 A T 14: 63,528,191 N418K possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr31 A T 14: 14,328,515 M135L probably benign Het
Psg16 T A 7: 17,095,305 Y271* probably null Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rnf220 A T 4: 117,489,884 S110R probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
St8sia5 T C 18: 77,232,806 Y49H probably damaging Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Urm1 G T 2: 29,832,699 A15S probably damaging Het
Other mutations in Fcrl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Fcrl5 APN 3 87444291 missense probably damaging 0.96
IGL01868:Fcrl5 APN 3 87443707 missense possibly damaging 0.58
IGL01939:Fcrl5 APN 3 87446299 missense probably damaging 0.99
IGL02817:Fcrl5 APN 3 87435913 missense probably benign 0.35
IGL03106:Fcrl5 APN 3 87435883 unclassified probably null
R0381:Fcrl5 UTSW 3 87446460 missense probably damaging 1.00
R0523:Fcrl5 UTSW 3 87457792 missense possibly damaging 0.72
R0646:Fcrl5 UTSW 3 87442013 missense probably benign 0.00
R1353:Fcrl5 UTSW 3 87448362 missense probably damaging 1.00
R1711:Fcrl5 UTSW 3 87457414 missense possibly damaging 0.61
R1714:Fcrl5 UTSW 3 87446406 missense probably damaging 1.00
R1719:Fcrl5 UTSW 3 87457397 missense probably damaging 0.98
R2084:Fcrl5 UTSW 3 87444230 missense probably benign 0.24
R2358:Fcrl5 UTSW 3 87446419 missense probably damaging 0.99
R2884:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R2885:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R3085:Fcrl5 UTSW 3 87446464 missense probably damaging 1.00
R3153:Fcrl5 UTSW 3 87443680 missense probably benign 0.09
R4288:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4289:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4614:Fcrl5 UTSW 3 87448426 missense probably damaging 1.00
R4719:Fcrl5 UTSW 3 87444189 missense probably damaging 1.00
R4788:Fcrl5 UTSW 3 87457188 missense probably damaging 1.00
R4920:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R4972:Fcrl5 UTSW 3 87454650 missense probably benign 0.00
R5373:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5374:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5963:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R5975:Fcrl5 UTSW 3 87442103 missense probably benign 0.00
R6022:Fcrl5 UTSW 3 87455763 missense probably benign 0.42
R6267:Fcrl5 UTSW 3 87448324 missense probably damaging 1.00
R6372:Fcrl5 UTSW 3 87444194 nonsense probably null
R6393:Fcrl5 UTSW 3 87448327 missense probably damaging 1.00
R7088:Fcrl5 UTSW 3 87457834 makesense probably null
X0054:Fcrl5 UTSW 3 87446299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCCAAAGCCAGGTCCTTCTC -3'
(R):5'- TGCACTTGTCAAAGTCACTGCCTAC -3'

Sequencing Primer
(F):5'- ccttctctctctccctccc -3'
(R):5'- tttaCATGAATTCTGTGCCATATCTG -3'
Posted On2014-01-29