Incidental Mutation 'R1231:St8sia5'
ID152311
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission 039300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1231 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77232806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 49 (Y49H)
Ref Sequence ENSEMBL: ENSMUSP00000078566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075290
AA Change: Y85H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: Y85H

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: Y49H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: Y49H

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 C T 10: 50,823,660 P1860S probably damaging Het
Cabp5 T C 7: 13,405,425 I125T probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Cmss1 C T 16: 57,316,197 R104H probably benign Het
Dock9 A T 14: 121,575,950 M1522K possibly damaging Het
Fcrl5 A G 3: 87,442,179 H87R probably benign Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Itgae C T 11: 73,119,379 T565I probably benign Het
Mocos G T 18: 24,679,701 A551S probably benign Het
Mtmr9 A T 14: 63,528,191 N418K possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr31 A T 14: 14,328,515 M135L probably benign Het
Psg16 T A 7: 17,095,305 Y271* probably null Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rnf220 A T 4: 117,489,884 S110R probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Urm1 G T 2: 29,832,699 A15S probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTGTGCCTGTCTTTCAATGGTGAC -3'
(R):5'- GGTAACTGAGCTGGGGACTTCAATG -3'

Sequencing Primer
(F):5'- GAAGTGGACTTTGTTCCTACAC -3'
(R):5'- CTCAGTCAGCAGACATGACTTTG -3'
Posted On2014-01-29