Incidental Mutation 'R1232:Gtf3c5'
ID152315
Institutional Source Beutler Lab
Gene Symbol Gtf3c5
Ensembl Gene ENSMUSG00000026816
Gene Namegeneral transcription factor IIIC, polypeptide 5
SynonymsTFIIICepsilon, TFIIIC63, 2700084A09Rik, TFiiiC2-63
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28566311-28583751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28571215 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 296 (W296R)
Ref Sequence ENSEMBL: ENSMUSP00000109521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028157] [ENSMUST00000113889]
Predicted Effect probably damaging
Transcript: ENSMUST00000028157
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028157
Gene: ENSMUSG00000026816
AA Change: W296R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tau95 23 322 2.8e-71 PFAM
coiled coil region 471 494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113889
AA Change: W296R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109521
Gene: ENSMUSG00000026816
AA Change: W296R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tau95 24 322 1.7e-85 PFAM
coiled coil region 477 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177012
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Gtf3c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Gtf3c5 APN 2 28569289 splice site probably null
R0062:Gtf3c5 UTSW 2 28572186 splice site probably benign
R0062:Gtf3c5 UTSW 2 28572186 splice site probably benign
R0395:Gtf3c5 UTSW 2 28577918 missense probably damaging 1.00
R0653:Gtf3c5 UTSW 2 28577996 missense probably benign 0.34
R1828:Gtf3c5 UTSW 2 28579682 missense probably damaging 1.00
R2174:Gtf3c5 UTSW 2 28567775 missense probably benign 0.26
R3154:Gtf3c5 UTSW 2 28579536 missense probably damaging 0.96
R4247:Gtf3c5 UTSW 2 28571184 missense probably damaging 1.00
R4612:Gtf3c5 UTSW 2 28579584 missense probably benign 0.00
R4673:Gtf3c5 UTSW 2 28572224 missense probably benign 0.20
R5092:Gtf3c5 UTSW 2 28582873 missense possibly damaging 0.58
R6009:Gtf3c5 UTSW 2 28571165 missense probably benign 0.00
R6334:Gtf3c5 UTSW 2 28570462 missense probably benign 0.00
R6808:Gtf3c5 UTSW 2 28570487 missense probably damaging 0.98
R7490:Gtf3c5 UTSW 2 28571141 missense not run
R7544:Gtf3c5 UTSW 2 28579542 missense not run
Predicted Primers PCR Primer
(F):5'- ACACTGGCACATCTAGCAGCTCTC -3'
(R):5'- GTTGTCACAGAAACTCCTGATCCCAC -3'

Sequencing Primer
(F):5'- tccacctgcttttgcctc -3'
(R):5'- AGAAACTCCTGATCCCACTTTATC -3'
Posted On2014-01-29