Incidental Mutation 'R1232:Cyp4a12b'
ID152319
Institutional Source Beutler Lab
Gene Symbol Cyp4a12b
Ensembl Gene ENSMUSG00000078597
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 12B
Synonyms
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115411624-115439034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115432563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 209 (D209V)
Ref Sequence ENSEMBL: ENSMUSP00000092487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094887
AA Change: D209V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092487
Gene: ENSMUSG00000078597
AA Change: D209V

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:p450 51 503 1.9e-132 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Cyp4a12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cyp4a12b APN 4 115438049 splice site probably null
IGL01571:Cyp4a12b APN 4 115438157 missense probably benign 0.00
IGL02230:Cyp4a12b APN 4 115433996 missense probably damaging 1.00
IGL02720:Cyp4a12b APN 4 115435171 splice site probably benign
IGL03118:Cyp4a12b APN 4 115432976 missense possibly damaging 0.54
IGL03389:Cyp4a12b APN 4 115433808 missense possibly damaging 0.90
R0360:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0364:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0844:Cyp4a12b UTSW 4 115432524 missense possibly damaging 0.67
R1226:Cyp4a12b UTSW 4 115432967 missense possibly damaging 0.80
R1372:Cyp4a12b UTSW 4 115432949 missense probably benign 0.08
R1559:Cyp4a12b UTSW 4 115433984 missense probably damaging 0.98
R1782:Cyp4a12b UTSW 4 115433981 missense probably damaging 1.00
R1817:Cyp4a12b UTSW 4 115414062 splice site probably benign
R1941:Cyp4a12b UTSW 4 115438059 missense probably damaging 1.00
R1978:Cyp4a12b UTSW 4 115438145 missense probably benign 0.01
R2063:Cyp4a12b UTSW 4 115433503 missense possibly damaging 0.87
R2109:Cyp4a12b UTSW 4 115432913 missense probably damaging 0.97
R2911:Cyp4a12b UTSW 4 115433526 nonsense probably null
R3791:Cyp4a12b UTSW 4 115434970 missense probably benign 0.01
R3815:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3816:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3817:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3818:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R4586:Cyp4a12b UTSW 4 115432506 missense probably damaging 1.00
R5004:Cyp4a12b UTSW 4 115438113 missense probably benign 0.39
R5105:Cyp4a12b UTSW 4 115433761 missense probably damaging 1.00
R5354:Cyp4a12b UTSW 4 115433464 splice site probably null
R5655:Cyp4a12b UTSW 4 115433797 missense probably damaging 1.00
R5814:Cyp4a12b UTSW 4 115432497 missense probably damaging 0.97
R5952:Cyp4a12b UTSW 4 115414517 nonsense probably null
R6004:Cyp4a12b UTSW 4 115433467 missense probably benign 0.35
R6059:Cyp4a12b UTSW 4 115438104 missense possibly damaging 0.94
R6261:Cyp4a12b UTSW 4 115414543 nonsense probably null
R7484:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCCTTCACAACATCTGATACAGGGA -3'
(R):5'- GCTATGACCCACAGACAGAGTGGTAA -3'

Sequencing Primer
(F):5'- GGAAATGAGTCTGTTCTACTTAGCAC -3'
(R):5'- TAGAAGATGGCTTCCCATTCAGG -3'
Posted On2014-01-29