Incidental Mutation 'R1232:Vmn2r15'
ID152321
Institutional Source Beutler Lab
Gene Symbol Vmn2r15
Ensembl Gene ENSMUSG00000091375
Gene Namevomeronasal 2, receptor 15
SynonymsEG211223
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109286269-109297556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109293302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 230 (D230G)
Ref Sequence ENSEMBL: ENSMUSP00000128333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167133]
Predicted Effect probably benign
Transcript: ENSMUST00000167133
AA Change: D230G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375
AA Change: D230G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Vmn2r15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r15 APN 5 109286736 missense possibly damaging 0.70
IGL01367:Vmn2r15 APN 5 109293209 missense probably damaging 0.99
IGL01844:Vmn2r15 APN 5 109286269 makesense probably null
IGL02190:Vmn2r15 APN 5 109293374 missense probably damaging 1.00
IGL02754:Vmn2r15 APN 5 109293268 nonsense probably null
IGL02797:Vmn2r15 APN 5 109297384 missense probably benign 0.18
IGL03301:Vmn2r15 APN 5 109297355 critical splice donor site probably null
IGL03407:Vmn2r15 APN 5 109286319 nonsense probably null
PIT4445001:Vmn2r15 UTSW 5 109287142 missense probably damaging 0.99
PIT4520001:Vmn2r15 UTSW 5 109287005 missense probably damaging 1.00
R0038:Vmn2r15 UTSW 5 109293144 missense possibly damaging 0.46
R0111:Vmn2r15 UTSW 5 109287156 missense possibly damaging 0.56
R0379:Vmn2r15 UTSW 5 109286478 missense probably damaging 1.00
R0427:Vmn2r15 UTSW 5 109287087 missense probably damaging 1.00
R0639:Vmn2r15 UTSW 5 109293015 missense probably benign 0.22
R0964:Vmn2r15 UTSW 5 109297535 missense probably benign 0.34
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1241:Vmn2r15 UTSW 5 109292904 missense probably damaging 1.00
R1244:Vmn2r15 UTSW 5 109293226 nonsense probably null
R1394:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1395:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1423:Vmn2r15 UTSW 5 109293227 missense probably damaging 1.00
R1439:Vmn2r15 UTSW 5 109294087 missense probably damaging 1.00
R1513:Vmn2r15 UTSW 5 109293329 missense probably damaging 1.00
R1777:Vmn2r15 UTSW 5 109294270 missense possibly damaging 0.79
R1844:Vmn2r15 UTSW 5 109286994 nonsense probably null
R2072:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2074:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2122:Vmn2r15 UTSW 5 109286456 missense probably damaging 1.00
R2208:Vmn2r15 UTSW 5 109297443 missense possibly damaging 0.64
R2268:Vmn2r15 UTSW 5 109293207 missense probably benign 0.31
R2831:Vmn2r15 UTSW 5 109286592 missense probably damaging 1.00
R3848:Vmn2r15 UTSW 5 109297446 missense probably benign 0.00
R4058:Vmn2r15 UTSW 5 109293446 missense probably damaging 0.99
R4615:Vmn2r15 UTSW 5 109293482 missense possibly damaging 0.91
R4663:Vmn2r15 UTSW 5 109294074 missense probably benign
R4681:Vmn2r15 UTSW 5 109286622 missense probably damaging 0.97
R4751:Vmn2r15 UTSW 5 109286754 missense probably benign 0.01
R5095:Vmn2r15 UTSW 5 109288451 critical splice acceptor site probably null
R5300:Vmn2r15 UTSW 5 109294108 missense probably damaging 0.99
R5309:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
R5335:Vmn2r15 UTSW 5 109286807 missense probably damaging 0.99
R5421:Vmn2r15 UTSW 5 109286535 missense probably damaging 1.00
R5805:Vmn2r15 UTSW 5 109286940 missense possibly damaging 0.88
R6280:Vmn2r15 UTSW 5 109293425 missense possibly damaging 0.65
R6324:Vmn2r15 UTSW 5 109286271 makesense probably null
R6383:Vmn2r15 UTSW 5 109293226 nonsense probably null
R6772:Vmn2r15 UTSW 5 109286372 missense probably damaging 0.99
R6991:Vmn2r15 UTSW 5 109293314 missense probably damaging 1.00
R7194:Vmn2r15 UTSW 5 109292783 missense probably damaging 1.00
R7365:Vmn2r15 UTSW 5 109293239 missense probably benign 0.19
R7365:Vmn2r15 UTSW 5 109297522 missense probably benign 0.15
R7423:Vmn2r15 UTSW 5 109297528 missense probably benign 0.00
X0065:Vmn2r15 UTSW 5 109293308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGCAAAAGTGACAGTTCCG -3'
(R):5'- CCTGAGTGACCATGACCAGTTTCC -3'

Sequencing Primer
(F):5'- GTGATAACATCCCATTGTGAGG -3'
(R):5'- AGTTTCCCTATGTCCATCAGGTAG -3'
Posted On2014-01-29