Incidental Mutation 'R1232:Sgsm1'
ID152322
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Namesmall G protein signaling modulator 1
SynonymsRutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location113243220-113310786 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 113273711 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 558 (C558*)
Ref Sequence ENSEMBL: ENSMUSP00000114932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
Predicted Effect probably null
Transcript: ENSMUST00000048112
AA Change: C503*
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: C503*

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057209
AA Change: C216*
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: C216*

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112325
AA Change: C503*
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: C503*

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147856
Predicted Effect probably null
Transcript: ENSMUST00000154248
AA Change: C558*
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: C558*

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 intron probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTCTGACCTGACAAGATGGCAC -3'
(R):5'- TGTCTGTCCAAAGACAAATCGTCCC -3'

Sequencing Primer
(F):5'- TGACAAGATGGCACCCCTC -3'
(R):5'- TTTAGTTGTCAGGACACCCAG -3'
Posted On2014-01-29