Incidental Mutation 'R1232:Olfr969'
ID152325
Institutional Source Beutler Lab
Gene Symbol Olfr969
Ensembl Gene ENSMUSG00000094254
Gene Nameolfactory receptor 969
SynonymsGA_x6K02T2PVTD-33492981-33493916, MOR171-7
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39790945-39796635 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39795968 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 198 (V198I)
Ref Sequence ENSEMBL: ENSMUSP00000149551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074566] [ENSMUST00000213266]
Predicted Effect probably benign
Transcript: ENSMUST00000074566
AA Change: V198I

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000074151
Gene: ENSMUSG00000094254
AA Change: V198I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-50 PFAM
Pfam:7tm_1 41 290 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213266
AA Change: V198I

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Olfr969
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr969 APN 9 39795378 start codon destroyed probably null 1.00
IGL02108:Olfr969 APN 9 39795512 missense probably damaging 0.99
IGL02999:Olfr969 APN 9 39795456 missense probably damaging 1.00
IGL03089:Olfr969 APN 9 39795681 missense probably benign 0.18
IGL03107:Olfr969 APN 9 39796179 missense probably benign 0.03
R1682:Olfr969 UTSW 9 39795658 nonsense probably null
R1796:Olfr969 UTSW 9 39796005 missense possibly damaging 0.82
R2152:Olfr969 UTSW 9 39795647 missense probably benign 0.01
R4534:Olfr969 UTSW 9 39796000 missense probably benign 0.00
R4941:Olfr969 UTSW 9 39795864 missense possibly damaging 0.78
R5239:Olfr969 UTSW 9 39796196 missense probably damaging 0.99
R5602:Olfr969 UTSW 9 39796194 missense possibly damaging 0.94
R6681:Olfr969 UTSW 9 39795414 missense probably benign 0.02
R6819:Olfr969 UTSW 9 39795609 missense probably benign 0.00
R7066:Olfr969 UTSW 9 39796124 missense probably benign 0.00
R7138:Olfr969 UTSW 9 39795790 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTGCCATCGGTAACCCCTTG -3'
(R):5'- TCAAAGGGTTCAGCATGGGCAC -3'

Sequencing Primer
(F):5'- ATGATGTCCTATCGAGTCTGTTC -3'
(R):5'- CTTGATCCATAGAGTTGACCGAAG -3'
Posted On2014-01-29