Incidental Mutation 'R1232:Glp1r'
ID152331
Institutional Source Beutler Lab
Gene Symbol Glp1r
Ensembl Gene ENSMUSG00000024027
Gene Nameglucagon-like peptide 1 receptor
SynonymsGLP-1R, GLP1Rc
MMRRC Submission 039301-MU
Accession Numbers

Genbank: NM_021332; MGI: 99571

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1232 (G1)
Quality Score172
Status Not validated
Chromosome17
Chromosomal Location30901867-30936510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30918931 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 112 (H112P)
Ref Sequence ENSEMBL: ENSMUSP00000110221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114574]
Predicted Effect probably benign
Transcript: ENSMUST00000114574
AA Change: H112P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110221
Gene: ENSMUSG00000024027
AA Change: H112P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
HormR 58 135 9.88e-27 SMART
Pfam:7tm_2 141 398 7.4e-82 PFAM
low complexity region 440 456 N/A INTRINSIC
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Glucose tolerance and pancreatic secretion is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Glp1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Glp1r APN 17 30901917 missense possibly damaging 0.96
IGL00516:Glp1r APN 17 30925558 missense probably damaging 1.00
IGL00653:Glp1r APN 17 30930760 missense probably damaging 1.00
IGL00917:Glp1r APN 17 30919469 splice site probably benign
IGL02005:Glp1r APN 17 30924611 missense probably benign 0.03
IGL02411:Glp1r APN 17 30924511 missense probably damaging 1.00
IGL02889:Glp1r APN 17 30931144 splice site probably benign
IGL02928:Glp1r APN 17 30918937 missense probably benign 0.00
N/A:Glp1r UTSW 17 30931283 missense probably damaging 0.98
R0135:Glp1r UTSW 17 30924577 missense probably benign 0.00
R0395:Glp1r UTSW 17 30936338 missense probably benign 0.34
R0481:Glp1r UTSW 17 30931217 missense probably benign 0.03
R0602:Glp1r UTSW 17 30909227 missense probably benign 0.12
R0841:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1804:Glp1r UTSW 17 30930713 splice site probably null
R1846:Glp1r UTSW 17 30929935 critical splice acceptor site probably null
R1982:Glp1r UTSW 17 30925627 nonsense probably null
R1990:Glp1r UTSW 17 30930748 missense possibly damaging 0.53
R2091:Glp1r UTSW 17 30925549 missense probably damaging 0.97
R3432:Glp1r UTSW 17 30924557 missense probably damaging 1.00
R4456:Glp1r UTSW 17 30918975 nonsense probably null
R4488:Glp1r UTSW 17 30918931 missense probably benign
R4610:Glp1r UTSW 17 30931247 missense probably benign 0.03
R4884:Glp1r UTSW 17 30936266 missense probably damaging 1.00
R5055:Glp1r UTSW 17 30918887 missense probably benign
R6358:Glp1r UTSW 17 30932644 missense probably benign 0.07
R6359:Glp1r UTSW 17 30929972 missense probably damaging 1.00
R6490:Glp1r UTSW 17 30924572 missense probably damaging 0.98
R6698:Glp1r UTSW 17 30936401 missense probably damaging 1.00
R7063:Glp1r UTSW 17 30925558 missense probably damaging 1.00
R7165:Glp1r UTSW 17 30909323 missense probably benign 0.23
R7293:Glp1r UTSW 17 30924625 missense probably benign 0.00
X0064:Glp1r UTSW 17 30919463 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCTGGATCGTAATGGGTGC -3'
(R):5'- ACTGATGATGTGACAGCAACTGCC -3'

Sequencing Primer
(F):5'- tgtgtgggggtgtgtgg -3'
(R):5'- CCCCACCCAAAGCCTAGAG -3'
Posted On2014-01-29